A covalent bond forms due to _____.

a. Sharing of electrons

b. Transfer of electrons

c. Losing or gaining electrons

d. All of the above

Answers

Answer 1
C l hope it's right : )

Related Questions

Which type of bleed would typically be more urgent to treat—venous or arterial?

Answers

Answer:

Arterial bleeding is more dangerous than venous bleeding. The arteries carry blood from the body and back into the heart. If the arteries become damaged and start to bleed out, an individual can suffer loss of life within five minutes if the bleeding is severe and if no medical attention is received.

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

Why are archaea in a different domain from bacteria?
A. They are multicellular, but bacteria are unicellular.
B. They are thought to have separate paths of evolutionary
development
C. They are able to perform endosymbiosis, but bacteria are not.
D. They have no similar characteristics.

Answers

Answer:B

Explanation:

Archaea is in a different domain from bacteria because they are thought to have separate paths of evolutionary development. Therefore, the correct statement is option B.

What are the differences between archaea and bacteria domains?

Archaea and bacteria are both prokaryotic organisms, but archaea are more closely related to eukaryotes than bacteria. Archaea have unique  lipid membrane and cell wall components that are different in composition than those found in bacteria.

These differences suggest that archaea and bacteria evolved to have separate paths of evolutionary development early in the history of life on Earth and then classified into Archaea and Bacteria domains.

Based on the phylogenetic tree constructed by researchers, the tree has classified life into three domains which are Archaea, Bacteria, and Eukarya These domains are based on their fundamental genetic and biochemical differences.

Therefore, archaea and bacteria are in a different domain because they followed separate paths of evolutionary development.

Learn more about the archaea domain here:

https://brainly.com/question/31089143

#SPJ5

Please help with this I’m being timed

Answers

Answer:

cell inhibitors

Explanation:

edge

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

5. What does Grover give Percy?

Answers

Answer:

Explanation:

Grover gives Percy a present in a shoebox and  it's the horn that Percy snapped off of the head of the Minotaur.

Answered by the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

HOPE THIS HELPED!!

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Help Me pls?!?!??? Plsssss

Answers

Answer:

its b

Explanation:

I remember I did this


BRAINIEST ANSWER!

HELP :))

Answers

Answer:

True

Explanation:

Don't know tell me if I'm wrong

Answer:

True

Explanation:

Actually it destroyed a LOT more than that...

If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?

Answers

Answer:

Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.

Explanation:

hope this helps:)

Help plzzzz!!!!!!!???!!!!!

Answers

The answer is A.
As the population increases, so will deforestation. With deforestation, habitats will be destroyed leading to a decrease.

Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be

Answers

Answer: Gg

Explanation:

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.


PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2

Answers

Answer:

109kg? would hit the ground with more force

Explanation:

Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:


2. After Fertilization, this part of a female flower eventually becomes the fruit
A. Style
B. Petal
C. Ovary
D. Sepal

Answers

C. Ovary! The ovary itself will mature into a fruit, either dry or fleshy, enclosing the seeds.

Answer:

ovary

Explanation:

After fertilization, the fertilized ovule forms the seed while the tissues of the ovary become the fruit

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2

how do radiation, conduction, and convection affect the atmosphere?​

Answers

Answer:

Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.

Explanation:

#KEEP LEARNING

I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2

Answers

Answer: 1. ??? 2. I cannot read it

Answer:

What does it say?

Explanation:

What helps meteorologists to forecast the weather?

Answers

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

Answer:

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.

In a sample of double stranded dna if 27% of the nitrogenous bases are thymine what percentage of nitrogenous bases are cytosine?

Answers

Answer:

73%

Explanation:

Given: 27%

To find: Percentage of nitrogenous bases are cytosine

Solve: [tex]\frac{27}{100}[/tex] × [tex]\frac{100}{1}[/tex]

Firstly, divide 100% by thymine and cytosine

[tex]\frac{100}{2}[/tex] = 50

Now, If it is 50 / 50, but thymine has 27 then subtract 27 from 100

100 - 27 = 73

So, the percentage of nitrogenous bases are cytosine 73%

where does mold come from?​

Answers

Mold is found everyone and can grow on almost any substance when moisture is presented. Mold could grow on non cellulose materials (plastic,metal, etc)

Volume of the large cube is 7.506 x 10 mm. The volume of each small cube is 2.78 X 104 mm'. How many small cubes make up the large cube?

Answers

Answer:

27

Explanation:

Identify how information for specifying the traits of an organism is carried in the DNA.

Answers

Answer: DNA carries all of the information for your physical characteristics, which are essentially determined by proteins. So, DNA contains the instructions for making a protein. In DNA, each protein is encoded by a gene (a specific sequence of DNA nucleotides that specify how a single protein is to be made).

Explanation:

The traits or characters are present in the DNA in the form of genes. Genes are short stretches of nucleotides present in DNA and represent the encoded message that is present in the individual.

What is a gene?

Genes are present in the DNA. It carries information about the traits that are expressed in an individual. Genes come from parents to offspring, so they are hereditary and pass from one generation to the next. From DNA, mRNA is formed from the gene by the process of transcription.

This mRNA is again converted to proteins or polypeptides by the process of translation. This product is the result of the message that is present in the gene. Example: melanin pigment and skin color variation. As different persons have variations in their genes, the production of this melanin protein synthesis varies, and as a result, skin color among individuals varies.

 

Hence, the information for specifying the traits is carried by genes present in DNA.

To learn more about the gene, refer to the following link:

https://brainly.com/question/16377110

#SPJ2

If your cells couldn't go through meiosis- how could this affect you?

Answers

Answer:

An organism would not be able to reproduce without meiosis.

Explanation:

Between meiosis and mitosis, meiosis is by far not as important. If you are a asexual organism, this would be NOT IMPORTANT whatsoever. If you are a sexual organism, this would LARGLY effect you. But on a world scale, this is NOT AS IMPORTANT.

This is because, without mitosis, you could not heal and would die much much younger since your cells could not be replaced. On the other hand, without meiosis, any organism that reproduces sexually would be unable to do so, which could lead to extinction in many, many species. This would not be harmful, however, to species that can also or mainly reporuduce asexually through budding, fragmenting, or sporing. So overall:

Organisms that produce sexually would go extinct.

This is the only real affect I can think of. Since meiosis does not  produce any cells aside from reproductive cells. And asexual organisms produce reproductive cells through other means.

Ti⊂k∫∈s ω∅∅p

Use the images below to answer the question. 2. What makes all of the samples different from each other?​

Answers

Answer:

Shape and structure.

Explanation:

The difference in shape and structure of these pictures is responsible for the difference from each other. The organisms present in these pictures are different in their size, shape and composition of their body. Some are small and some are large, some are living while the others are non-living, some are very hard whereas the others are soft and fleshy. So the organisms present in these samples are different from each other in a variety of ways i.e. size, shape and body structure.

Other Questions
MARTHAS STORY As a young child in Sierra Leone, Martha was told that she looked like her mother, so she spent hours in front of the mirror, trying to see in her own features an image of the mother she lost as a toddler. Marthas father, a successful businessman, cared deeply for his daughter. He bought her new clothes every week and took her to school every morning. In 2000, when Martha was eight years old, members of a rebel group trying to overthrow the government attacked her village. As the sound of gunfire filled the neighborhood, Martha and her father stayed locked inside their house for over a week, waiting for the fighting to stop. When things quieted down, rebels occupied the village, and the situation was tense. Marthas father saw his business drop off, and he was forced to move to a town he thought would be safe from rebel attack. There, he was able to rebuild his business and send money and clothes to his daughter. With her father gone, Martha moved in with her grandmother, who made a living by selling vegetables in the market. Sometimes Martha had to help her and missed school as a result. Her life became even more difficult when her grandmother had a severe stroke, which left her unable to walk and almost unable to speak. Martha, by then 13 years old, found herself caring for her ill grandmother and had no news from her father. Though Martha was barely able to keep up with schoolwork, she managed to pass the National Primary School Examination, which allowed her to go on to high school. However, with her father gone and her grandmother no longer able to work, there was no money for the necessary school fees. Marthas hopes for continuing her education now depended on her father, and she anxiously waited to hear from him. One morning, she received devastating news: the rebels had murdered her father. The whole world stopped for me, says Martha. For the first time in my life I felt alone. I realized I was an orphan. Martha is now staying with her stepmother (a woman her father married before his death and who she refers to as aunty) and her stepmothers three children. To help her new family, Martha sells biscuits in the street market, but she longs to go back to school. Luckily, her stepmothers new husband has shown sympathy toward her and is willing to help. The Impact of Armed Conflict Sierra Leones civil war (from 19912002) affected over 10,000 children like Martha, causing separation from their families and exposing them to violence. Some were injured or killed by landmines. Others were forced to serve as child soldiers. Many more children missed out on schooling and were often unable to get health care during the conflict. 1. List at least three ways in which armed conflict has affected Marthas life. List the words or phrases from the text that helped you identify the answer. 2. Martha has many responsibilities. What are two of those responsibilities? What words or phrases from the text helped you answer this question? Do you have similar or different responsibilities as Martha at home? 3. What else do you think is needed to support children and families involved in armed conflict?help me please choose the correct letter what is the purpose of the placenta ? 9. The boundary type you mentioned above can occur in 3 different ways (depending on the type crust).Which type of boundary would form folded mountains from plates pushing each other up?(circle all that apply)oceanic - oceanicoceanic-continental continental-continental10. Which type of boundary would force one plate under another plate? (called(circle all that apply)oceanic - oceanicoceanic-continental continental-continental11. Which type of convergent boundary did your model form?oceanic - oceanicoceanic-continentalcontinental-continental Laura goes to the carnival and receives 60 tokens to play games.each game required 4 tokens.At the end of the evening she used all of her tokens,how many games did laura play?A.10B.15C.16D.24 Which is most important: intelligence, beauty, or popularity? Why? The water released by the reaction (mass = 0.00020 g) was calculated as was theheat energy released (-9.6 x 10 kJ). Given the information you have about the 5accelerants, see if you can determine which liquid is the accelerant under thethreshold.1. Acetone:C3H60+02-CO2 +H20 =2. Coleman Fuel:C5H12 +02-CO2 +H20 =3. Ethyl alcoholC2H60 +02 -CO2 +H20 =4. Mineral Spirits:C10H22 +02-CO2 +H20 AH =5. Turpentine:C10H16 +02 -CO2 +H20 =The accelerant used wasIwhich is commonly found in: Rectangle ABCD has vertex coordinates A(1, -2), B(4,-2),C(4,-4), and D(1,-4). It is translated 1 unit to the left and 3units up. What are the coordinates of A?O A. (0,1)O B. (2,-5)O C. (4, -3)O D. (-2,-1) Ellos ____ tres hermanos.tenemostienentiene Please help I will give brainly What is the legal maximum speed limit permitted when driving in a residential area of the community? a. 15 mph b. 25 mph c. 35 mph d. 45 mph What is the legal maximum speed permitted for driving on the expressway-in Michigan? a. 45 mph b. 55 mph c. 60 mph d. 70 mph Will name brainliestReasons must be from this list:Reflexive property, segment bisector, angle bisector, linear pair, transitive property, perpendicular, SAS, ASA, CPCTC, AAS, HL, and SSSEvery word may not be used, but each may not be used more than once. y / 4 + 8 = 22 Answer? Which of these were laws designed to limit the freedoms of the newly freed African Americans?A. ImpeachmentB. Wade-Davis BillC. Black codesD. 10 percent plan Find the function rules. What did Britain do in response to the Great Depression? Hello good morning!! Anyone watch anime? My favorite is yu yu hakusho or one piece WILL GIVE BRAINLIEST TO CORRECT ANSWERSWhat policies did they support?Which Georgia politician was a famous populist? HHHHEEELPPPPPPPPPPPPPP LIKKEEEE RNNNNNWhich theme is found in "The Snow King? every Tuesday at 3 pm, flowers were delivered to my house Steam Workshop Downloader