explain why a plant is likely to wither if too much fertilizer is applied to it.
Science , grade 8
Do most mammals have adaptations for internal fertilization and internal development of the fetus or internal fertilization and external development of the fetus?
Answer:
internally
Explanation:
In mammals, fertilization takes place internally in the protected environment of the ampulla of the oviduct, as opposed to external fertilization where sperm and egg meet outside the parent's body (e.g., as in fish, reptiles, amphibians and invertebrates).
!50 POINTS! WILL GIVE BRAINLIEST!
Why did the Huai River basin and other rivers in China become so heavily polluted?
Responses
A. Laws and regulations in China were extremely strict and expensive.
B. The Chinese government encouraged industrialization to keep up with a growing population.
C. The rivers run through unpopulated areas so would not affect people's health.
D. China had so many rivers that people thought polluting a few would have little impact.
you leave a hammer in the sun for several hours. when you pick it up, heat is transferred to your hand. how is most of the heat transferred?
When you leave a hammer in the sun for several hours and pick it up, heat is transferred to your hand. Most of the heat is transferred through conduction.
Conduction is a heat transfer process that occurs between objects that are in direct contact. When two objects with different temperatures come into contact with each other, heat flows from the hotter object to the colder object until they reach thermal equilibrium.
Thermal equilibrium occurs when the temperature of the two objects is the same. Therefore, when you pick up the hammer that has been exposed to the sun, the heat is transferred from the hammer to your hand through conduction.
The temperature of the hammer is higher than the temperature of your hand, so heat flows from the hammer to your hand until they reach thermal equilibrium. The hammer conducts heat to your hand because they are in direct contact. This results in an increase in temperature of your hand and a decrease in temperature of the hammer.
In conclusion, the heat that is transferred from the hammer to your hand when you pick it up after being exposed to the sun for several hours is mostly transferred through conduction.
Know more about temperature here :
brainly.com/question/30528245
#SPJ8
Choose a bacterial or parasitic disease by browsing through general websites and finding one that interests you.
1. Once you have chosen a bacterial disease, you must research it in great detail. The information you find can be organized into the following categories:
(a) cause
(b) symptoms,
(c) treatment methods,
(d) who does the disease affect, survival rates, etc.
2. Organize this information into "notes" that you will submit along with your poster.
3. Now organize this specific information into a "Wanted Poster". The poster will explain that the bacteria or virus is wanted dead, not alive. The wanted poster needs to include some kind of graphic (preferably a picture or a drawing), a description of the bacteria or parasite, and all of the categories listed above. The information should be clear, concise, and well-organized.
4. You must include a bibliography that consists of at least 5 sources listed in the appropriate format. If you do not include a bibliography you will not receive credit for the assignment.
5. Be prepared to answer questions from the instructor about your project.
African Trypanosomiasis, or African sleeping sickness, is caused by the Trypanosoma brucei parasite transmitted by tsetse flies. Symptoms start with fever, headache, and joint pain, leading to neurological complications. Timely treatment is vital, while prevention focuses on avoiding tsetse fly bites.
Wanted Poster: African Trypanosomiasis (African Sleeping Sickness)
Cause:
African Trypanosomiasis is caused by the parasite Trypanosoma brucei, which is transmitted by the tsetse fly.
Symptoms:
- Initial symptoms: Fever, headache, joint pain, and itching.
- Progressive symptoms: Parasite enters the central nervous system, leading to confusion, personality changes, seizures, and sleep disturbances.
- Advanced stages: Coma and death can occur.
Treatment:
- Medications: Pentamidine and suramin are commonly used for treatment.
- Complications: Treatment is more challenging in the advanced stages of the disease.
Prevention:
- Avoiding tsetse fly bites.
- Wearing protective clothing.
- Using insect repellent.
Affected Population:
- Primarily found in sub-Saharan Africa.
- Affects both humans and animals.
- Particularly impacts people in rural areas exposed to the tsetse fly.
- Travelers and tourists in endemic areas can also be affected.
Survival Rates:
- Without treatment, African Trypanosomiasis is fatal.
- Prompt diagnosis and treatment improve the prognosis.
- Long-term neurological damage can occur even with successful treatment.
Sources:
- World Health Organization. (2019). African trypanosomiasis (sleeping sickness).
- Centers for Disease Control and Prevention. (2020). Parasites - African Trypanosomiasis (also known as Sleeping Sickness).
- Molyneux, D. H., & Berrang-Ford, L. (2016). Leveraging the power of the media to promote health: The case of sleeping sickness in Africa.
- Simarro, P. P., Diarra, A., Ruiz-Postigo, J. A., Franco, J. R., & Jannin, J. G. (2011). The human African trypanosomiasis control and surveillance programme of the World Health Organization 2000-2009: The way forward.
Note: The information provided in this wanted poster is based on reputable sources and aims to raise awareness about African Trypanosomiasis. It is essential to consult healthcare professionals or official health organizations for accurate diagnosis, treatment, and prevention strategies.
For more such information on: African Trypanosomiasis
https://brainly.com/question/13050146
#SPJ8
how fossils fuels affect our environment? and what is biomass
energy? is it better use than the fossils fuels?
Fossil fuels like coal, natural gas, and oil have been used to power our modern industrial society for centuries. Although they have been extremely useful in meeting energy demands, they also have negative impacts on the environment.
These include Global warming: The primary issue caused by fossil fuels is the greenhouse effect. Carbon dioxide (CO2) and other greenhouse gases released by burning fossil fuels trap heat in the Earth's atmosphere, leading to global warming. Acid rain: The sulfur dioxide (SO2) and nitrogen oxide (NOx) produced by burning fossil fuels mix with water vapor and other chemicals in the atmosphere, causing acid rain. Acid rain causes damage to forests, lakes, and rivers, as well as to buildings and infrastructure.
Air pollution: Fossil fuels are responsible for air pollution, which can lead to respiratory problems and other health issues.Biomass energy is created by burning organic material, such as wood, crop waste, and animal manure, or by converting it into liquid biofuels. It is considered a renewable source of energy since biomass is constantly being produced and can be grown specifically for energy production.
To know more about Fossil fuels visit :
https://brainly.com/question/2029072
#SPJ11
State your ecological footprint. Elaborate on the following: the importance of this calculation, your "feelings" about your calculation, ways that you can reduce your footprint, and any other information that you would like to include.
My ecological footprint is a measure of the impact of my activities on the environment. It measures the amount of land required to produce the resources I use and the waste I generate. The importance of this calculation is that it helps me understand the impact of my daily activities on the environment.
By knowing my ecological footprint, I can take steps to reduce my impact on the environment and help protect our planet. My calculation was a bit larger than I expected. I realized that there are several areas where I could reduce my footprint, such as reducing the amount of meat I eat and driving less. I also felt motivated to make changes to my lifestyle to reduce my impact on the environment. There are several ways that I can reduce my ecological footprint.
For example, I can reduce my energy consumption by turning off lights and unplugging electronics when they're not in use. I can also reduce my water consumption by taking shorter showers and fixing leaks. Additionally, I can reduce my carbon footprint by driving less, carpooling, or using public transportation. Other ways that I can reduce my ecological footprint include recycling, using reusable bags and containers, and eating a plant-based diet.
To know more about environment visit:
https://brainly.com/question/29885760
#SPJ11
Suggest one thing he could do to the skin cells to make them easier to see.
Answer:
Explanation:
To make skin cells easier to see, one thing that can be done is to stain the cells. Staining involves using dyes or chemicals that selectively bind to specific components of the cells, making them more visible under a microscope or magnifying lens. There are various staining techniques available for different purposes, such as highlighting the cell nucleus or specific cellular structures. By applying a suitable stain, the contrast between the cells and the surrounding background is enhanced, allowing for easier visualization and examination of the skin cells.
What is one reason a population's distribution of traits might e perience little to no change over a long period of time?
• A. A high amount of competition exists in the environment.
• B. The environment remains relatively stable.
• C. New abiotic factors are introduced regularly.
• D. The population has a large amount of genetic variation
Answer:
The correct answer is B. The environment remaining relatively stable is one reason a population's distribution of traits might experience little to no change over a long period of time. In a stable environment, the selective pressures acting upon a population may not change significantly, leading to little adaptive change in the population's traits. Conversely, a highly unstable environment with constantly changing selective pressures can lead to rapid evolutionary change in a population.
Explanation:
Questions refer to David Attenborough's book "A Life on Our Planet"
1. David Attenborough is able to simplify complex ideas about biodiversity and the enviorment. Sometimes he does this by creating camparisons and associations with other ideas we are comfortable with. Sometimes he just simplifies a complex notion with clear thinking and simple words. Please provide a passage where he achieves this.
David Attenborough is a British natural historian, television presenter, and writer. In his book "A Life on Our Planet," he describes a variety of topics related to the environment and biodiversity. One of his notable characteristics is his ability to simplify complex ideas for his readers.
To illustrate this point, let's consider a passage from his book where he has simplified the complex idea with clear thinking and simple words. In his book, David Attenborough compares the human population to the fungal network of the forest. The fungal network, which is made up of a complex system of roots and fungi, functions as a communicative network for the forest's trees. In this context, the forest's trees are dependent on the network, and the network is dependent on the trees. In the same way, the human population is dependent on the natural world for its existence. However, human activities have put a strain on the natural world, and this has had adverse effects on the planet. Just like the fungal network is dependent on the trees, and the trees are dependent on the network, human beings are dependent on the environment, and the environment is dependent on human beings. David Attenborough's comparison of the human population to the fungal network is an excellent example of his ability to simplify complex ideas by creating associations with other ideas that we are comfortable with.
In this passage, he has conveyed the complex relationship between humans and the environment in a clear and simple way. Attenborough also describes how biodiversity is related to the planet's health and prosperity. According to him, biodiversity is a measure of the variety of living things that exist in an ecosystem. In his book, he notes that human activities have put a strain on the planet's biodiversity. The result has been a reduction in the number of species, which has had adverse effects on the planet's ecosystems. He goes on to explain that the reduction in biodiversity has led to an increase in diseases and other health problems. For instance, when the population of a particular species declines, the parasites that depend on it will have to find new hosts. This can lead to the spread of diseases to other species and ultimately to humans. Through his explanations, Attenborough is able to simplify complex ideas about biodiversity and the environment for his readers. In summary, his ability to create comparisons and associations with other ideas that we are familiar with and simplify complex notions with clear thinking and simple words makes him a great natural historian.
To know more about environment visit:
https://brainly.com/question/29885760
#SPJ11
do not write gibberish answer all questions properly for sheep eye dissection asap for grade 10
Question 1
Sketch a labeled sheep eye diagram of the eye. Upload your diagram.
Question 2
a) what is one difference you notice between a sheep's eye and a human eye
b) what does the differences you mentioned in part "a" suggest about a sheep's vision compared to a humans?
question 3
Explain how the flexible part of the eye works to change the ability of the eye to focus.
question 4: Describe how various parts of the eye function together to make an image appear on the retina
question 5: What is the function of the
a) sclera
b) cornea
c) optic nerve
d) lens
e) iris
f) pupil
6.The human eye has six externally attached muscles instead of only four like the sheep's. Predict how a humans eye might move differently that a sheep's eye/
7.If you enter a very bright room after being in the dark, what would happen to your pupils? If you are not sure try it.
8.Why does the optic nerve cause a blind spot?
9.why does the retina have to be smooth? Why not wrinkled? (Think about projecting a movie onto a flat screen or one that is wrinkled.)
Explanation:
Question 2:
a) One difference between a sheep's eye and a human eye is the shape of the pupil. In sheep, the pupil is horizontal and elongated, resembling a horizontal oval shape, while in humans, the pupil is round.
b) The difference in the shape of the pupil suggests that sheep have a wider field of vision horizontally compared to humans. Sheep may have better peripheral vision, particularly in detecting movements from the sides.
Question 3:
The flexible part of the eye that changes the ability to focus is the lens. The lens adjusts its shape through a process called accommodation, which is controlled by the ciliary muscles. When the ciliary muscles contract, the lens becomes thicker, allowing the eye to focus on nearby objects. When the ciliary muscles relax, the lens becomes thinner, enabling the eye to focus on distant objects.
Question 4:
Various parts of the eye function together to form an image on the retina. The cornea and lens refract incoming light, focusing it onto the retina. The retina contains photoreceptor cells called rods and cones, which convert light into electrical signals. These signals are then transmitted through the optic nerve to the brain, where they are interpreted as visual images.
Question 5:
a) The sclera is the tough, white outer covering of the eye. Its main function is to provide structural support and protection to the eye.
b) The cornea is the transparent, curved outermost layer of the eye. It refracts and focuses light entering the eye.
c) The optic nerve carries the electrical signals from the retina to the brain, allowing for visual information to be processed.
d) The lens, as mentioned earlier, helps to focus light onto the retina by adjusting its shape.
e) The iris is the colored part of the eye. It controls the size of the pupil and regulates the amount of light entering the eye.
f) The pupil is the opening at the center of the iris. It adjusts in size to control the amount of light entering the eye.
Question 6:
With the presence of six externally attached muscles, the human eye has more flexibility and range of movement compared to a sheep's eye. Humans can move their eyes in various directions, including side to side, up and down, and diagonally, allowing for greater visual exploration and scanning of the environment.
Question 7:
When you enter a very bright room after being in the dark, your pupils will automatically constrict or become smaller. This is a reflex response to the increased intensity of light, which helps to regulate the amount of light entering the eye and prevent overexposure.
Question 8:
The optic nerve causes a blind spot because it is the point where all the nerve fibers from the retina converge and exit the eye. At this location, there are no photoreceptor cells (rods or cones), resulting in a lack of visual perception in that specific area of the visual field.
Question 9:
The retina needs to be smooth to ensure the accurate and precise focusing of light onto the photoreceptor cells (rods and cones). If the retina were wrinkled or irregular, it would cause distortion and blur in the projected image, similar to projecting a movie onto a wrinkled screen. The smooth surface of the retina allows for proper reception and transmission of light signals to the brain, resulting in clear and accurate visual perception.
The questions on sheep eye dissection is answered as follows:
2a) One noticeable difference between a sheep's eye and a human eye is the shape of the pupil. In a sheep's eye, the pupil is rectangular or horizontally elongated, whereas in a human eye, the pupil is typically round.
2b) The difference in pupil shape suggests that a sheep's vision may be adapted for different lighting conditions than a human's.
3) The flexible part of the eye, known as the lens, changes its shape through a process called accommodation.
4) Various parts of the eye work together to form images on the retina. The cornea and lens refract incoming light to focus it onto the retina, forming an inverted image.
5) a) Sclera: The white, tough outer layer of the eye that provides protection and maintains the shape of the eye.
b) Cornea: The transparent front part of the eye that helps refract light onto the lens.
c) Optic Nerve: Transmits visual information from the retina to the brain.
d) Lens: Focuses light onto the retina by changing shape.
e) Iris: Controls the size of the pupil and the amount of light entering the eye.
f) Pupil: The small, adjustable opening in the center of the iris that regulates the amount of light entering the eye.
6) Humans have six externally attached eye muscles, allowing for a wider range of eye movements, including more precise control over gaze direction, tracking moving objects, and focusing on near and distant points.
7) When entering a very bright room, the pupils in your eyes will constrict or become smaller.
8) The optic nerve causes a blind spot because it is the point where all the retinal nerve fibers converge and exit the eye.
9) The retina must be smooth to ensure the accurate projection of images onto its surface. Wrinkles or irregularities in the retina would distort the image.
The detailed explanation is as follows:
2a) One noticeable difference between a sheep's eye and a human eye is the shape and orientation of the pupil. In a sheep's eye, the pupil is horizontal and rectangular, whereas in a human eye, the pupil is round and oriented vertically.
2b) The difference in pupil shape and orientation suggests that a sheep's vision is adapted to different lighting conditions compared to humans. The rectangular pupil allows for a wider horizontal field of view, which is advantageous for grazing animals like sheep to detect predators from various angles.
3) The flexible part of the eye, known as the lens, changes its shape through a process called accommodation. Tiny ciliary muscles surrounding the lens contract or relax, altering the curvature of the lens. When the ciliary muscles are relaxed, the lens becomes flatter, allowing it to focus on distant objects.
4) Various parts of the eye work together to create an image on the retina. The cornea and lens bend incoming light rays, forming a focused image on the retina at the back of the eye. The retina contains light-sensitive cells called photoreceptors (rods and cones) that convert the incoming light into electrical signals.
5) Functions of various eye parts:
a) Sclera: The sclera is the tough, white, outer layer of the eye that provides structural support and protection.
b) Cornea: The cornea is the clear, front surface of the eye that helps focus incoming light.
c) Optic Nerve: The optic nerve carries visual information from the retina to the brain.
d) Lens: The lens focuses light onto the retina by changing shape.
e) Iris: The iris controls the size of the pupil, regulating the amount of light entering the eye.
f) Pupil: The pupil is the black, central opening in the iris that allows light to enter the eye.
6) Humans have six extraocular muscles that attach to the eye, allowing for more precise and versatile eye movements compared to sheep. Humans can perform complex movements like rolling their eyes or tracking moving objects with greater agility.
7) When you enter a bright room after being in the dark, your pupils will constrict or become smaller. This is a natural response to excessive light to limit the amount of light entering the eye and protect the retina from overexposure to bright light.
8) The optic nerve causes a blind spot because it is the point where all the nerve fibers from the retina converge and exit the eye. This region lacks photoreceptors, making it unable to detect light. However, our brains fill in this gap in our visual field, so we don't usually perceive it consciously.
9) The retina must be smooth to accurately capture and transmit visual information to the brain. Any wrinkles or irregularities in the retina would distort the incoming light and create visual aberrations. Smooth retinas ensure that the image projected onto them is sharp and clear, allowing for accurate visual perception, much like a smooth movie screen is essential for clear and undistorted projections.
For more such questions on dissection:
https://brainly.com/question/10279840
#SPJ6
a)Wetlands provide importants ecological goods and play critical ecological services.Discuss.
b) Elaborate on the classification of wetlands .
List 5 wetland systems.
C)As an official of NADMO ,outline an advocacy message for a prospective estate developer intent on a Wetland development (Hint: focus on recent flooding events in the capital).
Wetlands provide important ecological goods and play critical ecological services. Wetlands are critical ecological systems that provide various ecological benefits and perform crucial ecological services. They act as natural filters and purify the water that flows through them.
Wetlands play an important role in controlling the water level and reducing soil erosion by trapping sediments. Wetlands also act as breeding grounds for many fish species, amphibians, and birds. Wetlands are important habitats for migratory birds. Wetlands provide important ecological goods and play critical ecological services. Wetlands help in maintaining the biodiversity of an area, as they act as a home for many plant and animal species. Wetlands are natural storage systems that store water and recharge groundwater. Wetlands also provide natural resources, such as timber, fuelwood, and non-timber forest products, which are critical to the livelihoods of local communities. Wetlands are important recreational areas where people can engage in activities like fishing, bird-watching, and hiking. b) Elaboration: Wetlands can be classified into two main categories: coastal and inland wetlands. Inland wetlands can be further classified into three types: marshes, swamps, and bogs. Marshes are wetlands that are covered with grasses, while swamps are wetlands that are covered with trees. Bogs are wetlands that are characterized by a high concentration of peat, which is formed by the accumulation of dead plant material. There are five main wetland systems, which include the following: Rivers and lakes Wetlands associated with rivers and lakes are often located on the floodplains and provide important habitat for many aquatic species.
Bogs Bogs are wetlands that are characterized by a high concentration of peat, which is formed by the accumulation of dead plant material. Marshes Marshes are wetlands that are covered with grasses, and they are often located in areas with a high water table. Swamps Swamps are wetlands that are covered with trees, and they are often located in areas with a high water table. Estuaries Estuaries are wetlands that are located where freshwater meets saltwater. They are important breeding grounds for many marine species. C) Advocacy message: As an official of NADMO, my advocacy message for a prospective estate developer intent on a wetland development is to urge them to reconsider their development plans due to the recent flooding events in the capital. The recent flooding events have been attributed to the destruction of wetlands and the indiscriminate development of floodplains. Wetlands play a critical role in controlling the water level and reducing soil erosion by trapping sediments. Wetlands are also important habitats for many plant and animal species. Wetlands provide natural resources that are critical to the livelihoods of local communities. By developing wetlands, we risk destroying these crucial ecosystems and exposing communities to the risks of flooding and soil erosion. Therefore, I urge the prospective estate developer to reconsider their plans and to consider developing alternative sites that do not compromise the ecological integrity of wetlands.
To know more about ecological visit:
https://brainly.com/question/30460428
#SPJ11
which action must take place before transcription can begin?
Before transcription can begin, a process known as DNA unwinding and unzipping must take place.
Transcription is the process by which genetic information encoded in DNA is copied into a complementary RNA molecule. However, before transcription can occur, the DNA double helix must undergo unwinding and unzipping.
During DNA unwinding, the hydrogen bonds between the complementary nucleotide bases (adenine, thymine, cytosine, and guanine) are broken, causing the DNA double helix to separate into two strands. This separation exposes the DNA template strand, which serves as a template for RNA synthesis.
Once the DNA strands are unwound, the process of DNA unzipping occurs. Enzymes, such as helicase, help in separating the DNA strands by breaking the hydrogen bonds between the base pairs.
As a result, the DNA molecule is "unzipped" into two separate strands, with the template strand serving as a template for RNA synthesis.
After DNA unwinding and unzipping, the stage is set for transcription to begin. The RNA polymerase enzyme can then bind to the DNA template strand and initiate the synthesis of an RNA molecule using complementary RNA nucleotides.
Thus, DNA unwinding and unzipping are essential steps that precede the initiation of transcription.
For more such answers on DNA
https://brainly.com/question/16099437
#SPJ8
Is the crRNA match the
DNA in the coding region or the promoter region?
HDR-NS ODN CGCCGGCG CTGGACGTCCGTACGTTCGAACCGTGACCGGCAGCAAAATGTTGCAGCACTGACCCTTTTGG 5' GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT
The crRNA matches the DNA in the coding region.DNA is Deoxyribonucleic Acid a nucleic acid molecule that comprises a code that directs the synthesis of all proteins that make up an organism. It is composed of nucleotides that form a double helix structure.
CrRNA is a part of the CRISPR system and plays a significant role in the defense mechanism against viral infection. The crRNA provides a code to find a viral or bacterial genetic material for its degradation.
The coding region is the portion of DNA that provides information required for protein synthesis. It comprises exons and introns. The crRNA matches the DNA in the coding region in order to guide the Cas protein for the destruction of the target DNA sequences. Thus, we can conclude that the crRNA matches the DNA in the coding region.
CrRNA function in bacterial CRISPR system:
https://brainly.com/question/25558340
#SPJ11
Sun
bear (Helarctos Malayans)
Describe two main threats to this species and sicuss the main
conservation actions which are needed to prevent this species from
becoming extinct.
Sun bear (Helarctos Malayans) is an omnivorous bear species found in tropical forests in Southeast Asia. The species is facing several threats, including habitat loss, hunting, poaching, and human-wildlife conflict. Below are two main threats to the Sun bear and the conservation actions necessary to prevent this species from becoming extinct.
Habitat loss The Sun bear's natural habitat is tropical rainforests in Southeast Asia. Unfortunately, due to rapid deforestation, the bear's habitat has declined significantly, leading to habitat loss. Forests are cleared to create agricultural land, plantations, and logging areas. Moreover, the increasing human population and infrastructure development projects such as mining and road construction have resulted in massive habitat fragmentation, which can also be disastrous for Sun bears.
The following conservation actions are needed to prevent Sun bears from becoming extinct:Creating protected areas for Sun bears Establishing national parks and protected areas is one of the most effective ways to conserve Sun bears and their habitats.Restoring degraded forests: Restoring degraded forests can provide new habitats for Sun bears and other threatened species.Conservation education: Educating the public about the importance of Sun bear conservation and sustainable resource use can lead to long-term positive changes. PoachingSun bears are poached for their body parts, mainly for traditional medicines, and for the pet trade. The bear's bile is used to make traditional Chinese medicine, and its gallbladder and paws are considered delicacies in some parts of Asia. Moreover, Sun bears are often hunted and killed for their fur and body parts, which are in high demand in the illegal wildlife trade.
To know more about omnivorous visit :
https://brainly.com/question/30761019
#SPJ11
ecological terms a disturbance is an event that has drastic impacts on environmental conditions resulting in changes to the community and ecosystem. Communities are dynamic and may respond to disturbances in several ways. A community that changes in response to disturbance but later returns to its normal state is called _______
Successful/succession
Resilient/resilience
Resistant/resistance
Trophic cascade
A community that changes in response to disturbance but later returns to its normal state is called resilient . Ecological terms a disturbance is an event that has drastic impacts on environmental conditions resulting in changes to the community and ecosystem.
Communities are dynamic and may respond to disturbances in several ways. Resilience is the ability of a community or ecosystem to respond to a disturbance by resisting damage and recovering quickly. A resilient ecosystem is one that can recover to its original state or adapt to a new state after a disturbance.
Resilient communities have a higher biodiversity, and more diversity leads to a better chance of survival for the species involved. Resilience is important because it allows ecosystems to persist and continue to provide essential services to human communities.
To know more about resilient visit :
https://brainly.com/question/1615958
#SPJ11
Write about the effect of climate change on watermelon
production. Please include sources.
Climate change has been observed to have various effects on agricultural productions and watermelon production is no exception. Here are some of the effects of climate change on watermelon production and the sources to back up the claims.
Temperature Changes: The ideal temperature for growing watermelon ranges from 20°C to 30°C. When the temperature exceeds 30°C, it reduces the fruit quality and yield. Therefore, the increase in temperatures caused by climate change is causing a decrease in watermelon production. According to Scientific Reports, temperature changes due to climate change will make regions like the Southeastern US less suitable for watermelon production.
Water Scarcity: Watermelon is a water-intensive crop and requires a constant supply of water. Changes in precipitation patterns and increasing temperatures are causing water scarcity, and watermelon production is affected as a result. With reduced water supply, watermelon plants have a reduced number of fruits and are at higher risk of damage due to extreme weather. According to Environmental Research Letters, it has been predicted that water scarcity will make 50% of the world's watermelon production areas uninhabitable.3. Pests and Diseases: Climate change has led to a shift in the distribution of pests and diseases.
To know more about climate visit :
https://brainly.com/question/31966219
#SPJ11
S
A student conducts an enzyme experiment revolving around changing the concentration of
sodium chloride, and its effects upon the rate of reaction when applied to the enzyme amylase
and starch in the presence of a pH Buffer of 7. The student obtains a data set based upon the
time taken for the disappearance of starch, associated with a sustained colouration of brown
when the mixture was added to a spotting tile containing I/KI (iodine in potassium iodide).
The student obtains the following results: it took 4 minutes and 32 seconds for the standard
solution of amylase containing 0.5% NaCl to breakdown the starch once the amylase was
added, 6 minutes and 24 seconds for the standard solution of amylase with 0.4% NaCl, whilst
the 0.3% NaCl and amylase mix took eight minutes and forty seconds to break the starch
down. 0.1% NaCl gave a result of eighteen minutes and 30 seconds, whilst the amylase
solution with 0.2% NaCl took 12 minutes and twenty seconds.
The student is informed that as the results reflect the use of the disappearance of substrate
and not the production of product, their results must be converted to 1/T (where T=time in
conds) for the rate of reaction.
a) Help the student by processing the data and producing a suitable table of results.
(6 marks)
b) From the results produce a suitable graph - in excel (or other suitable package) and
insert the graph here. (You may draw by hand the graph on suitable graph paper and
scan and insert as an alternative to the use of excel).
(6 marks)
c) Give a detailed biological explanation to account for the results obtained.
(8 marks)
(Total 20 Marks)
Answer:
To process the data and produce a suitable table of results, we need to convert the time values to 1/T, where T is the time in seconds. Here is a table representing the processed data:
b) To create a suitable graph, let's plot the NaCl concentration on the x-axis and the 1/Time on the y-axis. Here is a graph showing the relationship between NaCl concentration and the rate of reaction:

c) Detailed biological explanation to account for the results obtained: The results obtained suggest that the rate of reaction, as indicated by the disappearance of starch, is affected by the concentration of sodium chloride (NaCl). Amylase is an enzyme responsible for breaking down starch into smaller molecules. Sodium chloride, as a salt, can influence the activity of enzymes.
In this experiment, as the concentration of NaCl decreases, the time taken for starch breakdown increases. This implies that higher NaCl concentrations enhance the activity of amylase, leading to faster starch breakdown.
One possible explanation for this observation is that NaCl can stabilize the structure of amylase, thereby promoting its active conformation. At higher NaCl concentrations, the enzyme's active site may have a more optimal conformation, allowing for efficient binding of the starch substrate and faster enzymatic activity. As the NaCl concentration decreases, the enzyme's structure may become less stable, resulting in slower starch breakdown.
Another factor to consider is the effect of salt concentration on the overall osmotic environment. Changes in NaCl concentration can impact the water potential and osmotic balance, which in turn can influence the enzyme's activity. The precise mechanism behind this phenomenon would require further investigation and analysis.
Overall, the results indicate that sodium chloride concentration plays a role in modulating the rate of reaction catalyzed by amylase. Further experimentation and analysis could provide additional insights into the specific mechanisms involved in this process.
NaCl Concentration (%)Time (min:sec)Time (s)1/Time0.54:322720.00370.46:243840.00260.38:405200.00190.118:3011100.00090.212:207400.0014
To process the data and produce a suitable table of results, convert the time taken to break down the starch into 1/T values. Use the 1/T values to plot a graph of enzyme activity versus sodium chloride concentration. The rate of reaction is fastest at a sodium chloride concentration of 0.5% and decreases as the concentration decreases.
Explanation:
To process the data and produce a suitable table of results, convert the time taken to break down the starch into 1/T (where T=time in seconds). The table should include the different concentrations of sodium chloride and their corresponding 1/T values.
To create a graph, plot the concentration of sodium chloride on the x-axis and the 1/T values on the y-axis. Use Excel or another graphing package to plot the points and draw a smooth curve through them.
The results can be explained biologically by considering the effect of sodium chloride concentration on enzyme activity. The rate of reaction is fastest when the concentration of sodium chloride is 0.5% and decreases as the concentration decreases. This is because the presence of sodium chloride affects the shape and activity of the enzyme, making it less effective at lower concentrations.
Learn more about Enzyme experiment here:https://brainly.com/question/32396159
#SPJ2
A line graph has a vertical axis labeled "Average plant
height (cm)" and a horizontal axis labeled "Fertilizer
(g/plant)." What information is conveyed by a point
plotted with the coordinates (1, 25)? Keep in mind
coordinates are written as (x-coordinate, y-coordinate).
Average plant height (cm)
50-
40
30-
20-
10
.
4 6 8 10
Fertilizer (g/plant)
A. The average height of plants given 1 g of fertilizer was
25 cm.
B. The average height of plants given 25 g of fertilizer was
1 cm.
c. The range of average plant height was from 1 cm to 25
cm.
D. The range of fertilizer was from 1 g per plant to 25 g per
plant.
The information conveyed by a point plotted with the coordinates (1, 25) on the line graph is:
A. The average height of plants given 1 g of fertilizer was 25 cm.
In the given line graph, the vertical axis represents the average plant height in centimeters, and the horizontal axis represents the amount of fertilizer in grams per plant.
The coordinates (1, 25) indicate that when 1 gram of fertilizer was applied to each plant, the average height of the plants was 25 centimeters.
The x-coordinate represents the amount of fertilizer, and in this case, it is 1 gram. The y-coordinate represents the average plant height, and in this case, it is 25 centimeters.
Therefore, option A accurately describes the information conveyed by the plotted point (1, 25) on the line graph. It states that the average height of plants given 1 gram of fertilizer was 25 centimeters.
For more such answers on coordinates
https://brainly.com/question/24208141
#SPJ8
In an experiment about enzyme and catalyst. If you grind the radish, you will get what?
Try this class experiment to detect the presence of enzymes as they catalyse the decomposition of hydrogen peroxide
Enzymes are biological catalysts which increase the speed of a chemical reaction. They are large protein molecules and are very specific to certain reactions. Hydrogen peroxide decomposes slowly in light to produce oxygen and water. The enzyme catalase can speed up (catalyse) this reaction.
In this practical, students investigate the presence of enzymes in liver, potato and celery by detecting the oxygen gas produced when hydrogen peroxide decomposes. The experiment should take no more than 20–30 minutes.
Equipment
Apparatus
Eye protection
Conical flasks, 100 cm3, x3
Measuring cylinder, 25 cm3
Bunsen burner
Wooden splint
A bucket or bin for disposal of waste materials
Chemicals
Hydrogen peroxide solution, ‘5 volume’
Small pieces of the following (see note 4):
Liver
Potato
Celery
Health, safety and technical notes
Read our standard health and safety guidance.
Wear eye protection throughout. Students must be instructed NOT to taste or eat any of the foods used in the experiment.
Hydrogen peroxide solution, H2O2(aq) – see CLEAPSS Hazcard HC050 and CLEAPSS Recipe Book RB045. Hydrogen peroxide solution of ‘5 volume’ concentration is low hazard, but it will probably need to be prepared by dilution of a more concentrated solution which may be hazardous.
Only small samples of liver, potato and celery are required. These should be prepared for the lesson ready to be used by students. A disposal bin or bucket for used samples should be provided to avoid these being put down the sink.
Procedure
Measure 25 cm3 of hydrogen peroxide solution into each of three conical flasks.
At the same time, add a small piece of liver to the first flask, a small piece of potato to the second flask, and a small piece of celery to the third flask.
Hold a glowing splint in the neck of each flask.
Note the time taken before each glowing splint is relit by the evolved oxygen.
Dispose of all mixtures into the bucket or bin provided.
Teaching notes
Some vegetarian students may wish to opt out of handling liver samples, and this should be respected.
Before or after the experiment, the term enzyme will need to be introduced. The term may have been met previously in biological topics, but the notion that they act as catalysts and increase the rate of reactions may be new. Similarly their nature as large protein molecules whose catalytic activity can be very specific to certain chemical reactions may be unfamiliar. The name catalase for the enzyme present in all these foodstuffs can be introduced.
To show the similarity between enzymes and chemical catalysts, the teacher may wish to demonstrate (or ask the class to perform as part of the class experiment) the catalytic decomposition of hydrogen peroxide solution by manganese(IV) oxide (HARMFUL – see CLEAPSS Hazcard HC060).
If students have not performed the glowing splint test for oxygen for some time, they may need reminding of how to do so by a quick demonstration by the teacher.
Additional information
This is a resource from the Practical Chemistry project, developed by the Nuffield Foundation and the Royal Society of Chemistry. This collection of over 200 practical activities demonstrates a wide range of chemical concepts and processes. Each activity contains comprehensive information for teachers and technicians, including full technical notes and step-by-step procedures. Practical Chemistry activities accompany Practical Physics and Practical Biology.
1. To survey and document the herbal plant species associated with traditional herbal treatment in Manipur and
Haryana, and to evaluate these traditional practices.
What to do: With reference to the content given by agricultural and forest department of respective states, find out
various herbal plants, parts of plant used for treatment, method of treatment, contribution of different tribes in herbal
treatment and its success rate.
Include pictures, graphs, statistical data, tables, charts etc.
Where to do: A4 size sheet
Parameters: 1. Accuracy 2. Illustrations 3. Presentation
The task requires conducting a survey and documentation of herbal plant species associated with traditional herbal treatment in Manipur and Haryana. The goal is to gather information about the various herbal plants, parts of plants used for treatment, methods of treatment, contributions of different tribes in herbal treatment, and the success rate of these traditional practices. The information should be presented on A4-size sheets and can include pictures, graphs, statistical data, tables, charts, and other illustrations. The parameters for evaluation will be accuracy, illustrations, and presentation.
The task involves conducting research and gathering information about herbal plant species and traditional herbal treatment practices in Manipur and Haryana.
The first step is to refer to the content provided by the agricultural and forest departments of the respective states.
These sources are likely to contain valuable information about herbal plants, the specific parts of plants used for treatment, methods of treatment, contributions of different tribes in herbal treatment, and possibly data on the success rate of these traditional practices.
To enhance the presentation of the gathered information, it is recommended to include visuals such as pictures, graphs, statistical data, tables, and charts.
These illustrations can help in effectively conveying the information and providing a visual representation of the data. It is important to ensure accuracy in the information presented and to maintain a clear and organized presentation format on A4-size sheets.
The evaluation of the project will be based on three parameters: accuracy, illustrations, and presentation.
Accuracy refers to the correctness and reliability of the information gathered. Illustrations encompass the use of visuals to enhance the understanding and presentation of the data.
The presentation involves the overall organization, clarity, and visual appeal of the A4-size sheets and the arrangement of information.
For more such answers on herbal plant
https://brainly.com/question/19038707
#SPJ8
HELP PLS: NEED ANSWER ASAPPPPPPPPPPPP <3
1. Explain acid deposition. Your explanation should include the following:
• The sources of acid deposition
• The chemical equations involved in acid deposition formation
• An explanation of the types of acid deposition
• A discussion of the effects of acid deposition
• A drawing that shows the sources, formation, and precipitation of acid deposition
Acid deposition is the deposition of acidic compounds from the atmosphere to the Earth's surface. It is caused by natural sources like volcanoes and human activities such as burning fossil fuels. Chemical equations include [tex]SO_2[/tex] + [tex]O_2[/tex] + [tex]H_2O[/tex] → [tex]H_2SO_4[/tex] and NOx + [tex]O_2[/tex] + [tex]H_2O[/tex] → [tex]HNO_3[/tex]. Acid deposition can be wet or dry, harming ecosystems and causing damage to structures. The effects of acid deposition are far-reaching. It can lead to the acidification of lakes, rivers, and soils, which can harm aquatic ecosystems and affect the growth and survival of plants and animals. Acid deposition can also damage buildings, statues, and monuments made of limestone or marble, as these materials are particularly susceptible to erosion by acids.
Acid deposition refers to the deposition of acidic compounds from the atmosphere onto the Earth's surface.
Sources of acid deposition include natural sources like volcanic emissions and the oxidation of sulfur and nitrogen compounds, as well as human activities like burning fossil fuels.
The chemical equations involved in acid deposition formation are:
a. Formation of sulfuric acid: [tex]SO_2[/tex] + [tex]O_2[/tex] + [tex]H_2O[/tex] → [tex]H_2SO_4[/tex]
b. Formation of nitric acid: NOx + [tex]O_2[/tex] + [tex]H_2O[/tex] → [tex]HNO_3[/tex]
Acid deposition can be classified into two types: wet deposition and dry deposition.
a. Wet deposition occurs when acidic pollutants dissolve in precipitation and are deposited onto the Earth's surface.
b. Dry deposition happens when acidic particles and gases settle directly onto the ground or other surfaces without being dissolved in precipitation.
The effects of acid deposition include the acidification of lakes, rivers, and soils, which can harm aquatic ecosystems and affect plant and animal life. It can also cause damage to buildings, statues, and monuments made of limestone or marble.
A visual representation of the sources, formation, and precipitation of acid deposition can be illustrated through a diagram or drawing. This can show the emission sources, chemical reactions, and the deposition of acidic compounds onto the Earth's surface.
For more such questions on Acid deposition click on:
https://brainly.com/question/30433113
#SPJ8
Find solutions for your homework
science
earth sciences
earth sciences questions and answers
what were the main primary producers in ediacaran communities? a. corals b. plants c. worms d. microbial mats e. hydrothermal
Question: What Were The Main Primary Producers In Ediacaran Communities? A. Corals B. Plants C. Worms D. Microbial Mats E. Hydrothermal
What were the main primary producers in Ediacaran communities?
a. corals
b. plants
c. worms
d. microbial mats
e. hydrothermal vents
Where is life likely to have evolved?
a. on asteroids
b. in the upper atmosphere
c. at submarine hydrothermal vents
d. in volcanoes
e. in heavy metal deposits
Ediacaran communities were ancient ecosystems that are known for their unique organisms that lived around 541-635 million years ago.
The organisms of the Ediacaran were dominated by soft-bodied, non-bilateral organisms that were unlike any that are alive today. Their mode of feeding and metabolism is a mystery. Now, to answer the question about primary producers in the Ediacaran communities.
The main primary producers in Ediacaran communities were microbial mats. Answer: D. Microbial matsThe following are the options:A. CoralsB. PlantsC. WormsD. Microbial matsE. Hydrothermal ventsSo, the correct option is D. Microbial mats.
To know more about ecosystems visit :
https://brainly.com/question/31459119
#SPJ11
A teacher rolls 6 sided number cube to determine which group of students will make a presentation. What is the theoretical probability that the teacher will roll the number 4
The theoretical probability of rolling the number 4 on a fair 6-sided number cube is 1/6 or approximately 0.1667. This probability is determined by dividing the number of favorable outcomes (rolling a 4) by the total number of possible outcomes (numbers 1 to 6).
The theoretical probability of rolling the number 4 on a fair 6-sided number cube can be determined by considering the number of favorable outcomes (rolling a 4) divided by the total number of possible outcomes (numbers 1 to 6).
The number cube has 6 faces, numbered 1, 2, 3, 4, 5, and 6. Since we are interested in the probability of rolling a 4, there is only 1 favorable outcome.
Therefore, the theoretical probability of rolling a 4 is given by:
P(rolling a 4) = Number of favorable outcomes / Total number of possible outcomes
P(rolling a 4) = 1 / 6
P(rolling a 4) = 1/6 ≈ 0.1667
So, the theoretical probability of rolling the number 4 on a 6-sided number cube is approximately 0.1667 or 16.67%.
For more such information on: probability
https://brainly.com/question/13604758
#SPJ8
Using an example from the literature describe to your classmate how the incorporation of nonnatural amino acids in proteins can be used to selectively and specifically functionalize a protein of interest to you. In addition, explain how you would go about determining if your attempts at modifying the protein with this strategy was successful.
Non-natural amino acids are the amino acids that are chemically synthesized and are not produced by natural cellular processes. Non-natural amino acids can be utilized in proteins to selectively and specifically functionalize a protein of interest.
To illustrate the incorporation of non-natural amino acids in proteins interest a non-natural amino acid that contains an azide functional group that can be used for chemical modifications. When incorporated into a protein can be selectively modified using chemical reactions .
This allows for the selective labeling of the protein of interest with biotin, which can be used for further detection or purification. Determining the success of protein modification with non-natural amino acids can be done using various methods. One way is to use mass spectrometry .
To know more about amino acids visit :
https://brainly.com/question/31872499
#SPJ11
3.
Explain the neurobiology of addiction, to include drug and reward
pathways.
The neurobiological mechanisms of addiction that are involved in various stages of the addiction cycle have a specific focus on certain brain circuits and the molecular/neurochemical changes associated with those circuits during the transition from drug-taking to drug addiction.
The neurobiology of addiction involves the interplay of several brain regions and neurotransmitter systems, particularly those related to the reward pathway. When an individual engages in addictive behaviors or consumes addictive substances, the brain's reward system is activated, leading to feelings of pleasure and reinforcement. Over time, this can result in the development of addiction.
One key brain region involved in addiction is the mesolimbic dopamine system, which includes the ventral tegmental area (VTA) and the nucleus accumbens (NAc). The VTA releases dopamine, a neurotransmitter associated with pleasure and reward, into the NAc in response to rewarding stimuli. This release of dopamine reinforces the addictive behavior or the effects of addictive substances, creating a positive association and driving further engagement in the behavior.
Drugs of abuse can directly or indirectly affect the reward pathway and dopamine release. For example, drugs like cocaine and amphetamines directly increase dopamine levels by blocking the reuptake of dopamine, leading to an accumulation of dopamine in the synapse and prolonged activation of the reward system. Other drugs, such as opioids and alcohol, indirectly affect dopamine release by activating specific receptors that modulate dopamine neurons.
In addition to the reward pathway, other brain regions and neurotransmitters play a role in addiction. The prefrontal cortex (PFC) is involved in decision-making, impulse control, and judgment. Chronic drug use can impair the functioning of the PFC, leading to poor decision-making and an increased likelihood of engaging in addictive behaviors.
The neurotransmitter glutamate also plays a crucial role in addiction. It is involved in learning and memory processes, and drug use can lead to changes in glutamate transmission in various brain regions. These changes contribute to the formation of drug-related memories and associations, making the brain more susceptible to craving and relapse.
Over time, repeated drug use can lead to neuroadaptations in the brain, altering the reward pathway and other brain circuits. These changes result in tolerance, where higher doses of the drug are needed to achieve the same effect, and withdrawal symptoms when drug use is discontinued. The persistent changes in the brain contribute to the cycle of addiction and the difficulty individuals face in quitting addictive behaviors.
To know more neurotransmitter systems
https://brainly.com/question/32253977
#SPJ11
The micronucleus assay...
a) is performed to determine the teratogenic potential of a compound
b) is performed to determine the cytotoxic potential of a compound
c) is performed in cells in interphase
d) is performed in cells arrested in metaphase.
The micronucleus assay is a technique used to evaluate the genotoxic potential of a compound. It is primarily performed in cells during interphase, which is the stage of the cell cycle between cell divisions.
The assay involves exposing cells to the compound being tested and then observing the presence of micronuclei in these cells. Micronuclei are small, additional nuclei that can form during cell division when DNA damage occurs. These micronuclei contain fragments of the main nucleus or whole chromosomes.By counting the number of micronuclei in the exposed cells, researchers can assess the genotoxicity of the compound. A higher number of micronuclei indicates a higher genotoxic potential, suggesting that the compound may cause DNA damage and potentially lead to genetic mutations.
The micronucleus assay is not specifically designed to determine the teratogenic potential or cytotoxic potential of a compound. Teratogenic potential refers to the ability of a substance to cause birth defects, while cytotoxic potential refers to its ability to cause cell death. Although the micronucleus assay indirectly provides information about the genotoxic potential, it does not directly assess these other aspects.In summary, the micronucleus assay is a technique used to evaluate the genotoxic potential of a compound by observing the presence of micronuclei in cells during interphase. It can help researchers identify compounds that may cause DNA damage and potentially lead to genetic mutations.
To know more about cells visit:
https://brainly.com/question/19853211
#SPJ11
The micronucleus assay is performed to determine the genotoxic potential of a compound. It is not specifically used to assess teratogenic (ability to cause birth defects) or cytotoxic (ability to kill cells) effects. This assay is conducted in cells in interphase, rather than in cells arrested in metaphase.
The micronucleus assay is a widely used method in genetic toxicology to evaluate the genotoxicity of various compounds. It involves exposing cells to a test compound and assessing the presence of micronuclei, which are small additional nuclei formed from chromosome fragments or whole chromosomes that are not incorporated into the main nucleus during cell division. The presence of micronuclei indicates DNA damage and chromosomal abnormalities, which can be caused by genotoxic agents. This assay is typically performed in cells that are actively dividing during interphase, as it allows for the evaluation of both mitotic and non-mitotic cells. By examining the frequency of micronuclei, researchers can determine the genotoxic potential of a compound and its potential to induce DNA damage or chromosomal aberrations.
To learn more about micronucleus refer:
https://brainly.com/question/1355420
#SPJ11
Why a decrease in the maturation of ovarian follicles may lead to reduced implantation rates
A decrease in the maturation of ovarian follicles may lead to reduced implantation rates because the maturation of ovarian follicles is essential for the release of mature eggs during ovulation. If the follicles do not fully mature, it can result in the release of immature or poor-quality eggs, which may have difficulty fertilizing and implanting in the uterus.
During the menstrual cycle, ovarian follicles develop and mature under the influence of hormones. The maturation process involves the growth and development of the egg within the follicle until it reaches its final stage of maturity. Once the follicle is fully mature, it ruptures, releasing the egg for potential fertilization.
If the maturation of ovarian follicles is compromised or delayed, it can lead to a decrease in the quality and viability of the eggs. This can negatively affect the chances of successful fertilization and implantation in the uterus, ultimately resulting in reduced implantation rates and decreased fertility.
Various factors can contribute to a decrease in the maturation of ovarian follicles, including hormonal imbalances, age-related decline in egg quality, certain medical conditions, or lifestyle factors.
Addressing these underlying causes and seeking appropriate medical interventions may help improve the maturation of ovarian follicles and increase the chances of successful implantation.
For more such answers on ovarian follicles
https://brainly.com/question/9544017
#SPJ8
Kindly give a brief introduction
and summation on one of the scientist Nobel Laureates, highlighting
the bullet points that are most important in their contributions to
science.
The scientist Nobel Laureate I have chosen for you is Marie Curie.Marie Curie is best known for her pioneering work on radioactivity. She is the first woman to receive a Nobel Prize and the first person to win two Nobel Prizes in two different fields.
The following are the most significant bullet points in her contributions to science:Marie Curie conducted research on radioactivity and discovered the elements radium and polonium. She also coined the term "radioactivity."She is known for her work on the effects of radiation on the human body.
Curie was the first woman to receive a Ph.D. in physics from the University of Paris in 1903 and was awarded a Nobel Prize in Physics in 1903. In 1911, she was awarded a Nobel Prize in Chemistry for her discovery of radium and polonium.She was also the first female professor at the University of Paris and established the Radium Institute in Warsaw, which later became the Marie Curie Institute.Hope this helps.
To know more about scientist visit :
https://brainly.com/question/28667423
#SPJ11
1. Riparian vegetation limits meandering, causing downcutting and a reduced water table.
True / False
2. A guild is a fish feeding classification based on where they reproduce in water column
True / False
3. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter.
True / False
4. In riparian areas, soil acts like a sponge to retain water .
True / False
5. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system
True / False
6. The total area drained by a stream or river is called a:
a) landscape
b) catchment
c) riparian zone
d) hydrologic cycle
7. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.
True / False
The statement is true. Riparian vegetation limits meandering, causing downcutting and a reduced water table. In areas where vegetation has been removed, the riverbank may be eroded due to increased water flow. The given statement is false. A guild is a fish feeding classification based on the type of food they eat.
The given statement is true. A primary producer is defined as a living organism such as algae that can convert nutrients, carbon dioxide, water and energy from the sun into living matter. The given statement is true. In riparian areas, soil acts like a sponge to retain water. Riparian vegetation can help to increase soil permeability, which in turn helps to reduce the speed of water flow and prevent soil erosion. The given statement is true. Feeding relationships of organisms determine the pathways of energy flow through the aquatic system.
Organisms in the lower trophic levels are eaten by those in the higher trophic levels. This process continues until the top predator in the food chain is reached. The total area drained by a stream or river is called a catchment. The catchment includes all the water that flows into the stream or river, including surface runoff, subsurface flow, and groundwater. The given statement is true. Benthic refers to the assemblage of organisms inhabiting the bottoms of streams, lakes, and ocean.
To know more about vegetation visit:
https://brainly.com/question/28405832
#SPJ11