A solution is prepared by dissolving 250 g of CH4N2O into 6.0 L of solution. What is the molarity of this solution?

________M​

Answers

Answer 1

Answer:

Molarity = 0.65 M

Explanation:

Given data:

Mass of CH₄N₂O  = 250 g

Volume of solution = 6.0 L

Molarity of solution = ?

Solution:

Molarity is used to describe the concentration of solution. It tells how many moles are dissolve in per litter of solution.

Formula:

Molarity = number of moles of solute / L of solution

Number of moles of solute:

Number of moles = mass/molar mass

Number of moles = 250 g/ 64.08 g/mol

Number of moles = 3.9 mol

by putting values,

Molarity = 3.9 mol / 6.0 L

Molarity = 0.65 M


Related Questions

J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons

Answers

He announced that cathode rays consisted of a steam of Electrons.

Indicate which one of the two species is larger
A. Mg2+ or Ca2+

Answers

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.

(HELP FAST )The model shows a molecule of silk made by a spider.

Answers

An atom is each sphere which are all connected

Draw the structure of 2-bromo, 3-chloro-4,4-dimethyl

Answers

Answer:

The compound you are asking for is not complete. But I will give you the answer to one of the compounds.

The complete compound is:

2-bromo, 3-chloro-4,4-dimethylpentane.

Attached is the structure of the compound.

Explanation:

2-bromo, 3-chloro-4,4-dimethylpentane is an organic compound. It's molecular formula is C₇H₁₄BrCl.

This compound has bromine and chlorine attached to the backbone carbon of the pentane compound. The bromine and chlorine are attached to the second and third backbone carbon of the compound respectively.

Also, the dimethyl means that the compound has two methyl (CH₃) attached to the same carbon which is the number 4 backbone carbon.

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

When iso-propanol burns in oxygen, carbon dioxide and water are produced

Answers

Explanation:

When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

2. Why do ions form?

Answers

Answer:

When atoms lose or gain electrons, they become positively or negatively charged ions. In an ionic compound, the ions are arranged in a three-dimensional structure called a crystal. ... When an atoms gains or loses electrons, it gains a charge, thus becoming an ion.

Explanation:

Answer:

The iron ore deposits began forming when the first organisms capable of photosynthesis began releasing oxygen into the waters.

Explanation:

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

what is observed when an iron bar is dipped into a solution of silver nitrate​

Answers

Answer:

I think it will start to have a greenish color and get lighter

Explanation:

What is the wavelength of a wave with energy equal to 1.528 x 10-13 J? E=hc/LaTeX: \lambdaλ Energy= Measured in Joules h=Plank's constant, 6.626 x 10-34 J x s c=speed of light, 3.00 x108 m/s LaTeX: \lambdaλ= wavelength in meters Group of answer choices 1.301 x 1029 m 6.918 x 1028m 6.918 x 10-13m 1.301 x 10-12m

Answers

Answer:

1.301 × 10⁻¹² m

Explanation:

Step 1: Given and required data

Energy of the electromagnetic wave (E): 1.528 × 10⁻¹³ JPlanck's constant (h): 6.626 × 10⁻³⁴ J . sSpeed of light (c): 3.00 × 10⁸ m/s

Step 2: Calculate the wavelength (λ) of the electromagnetic wave

We can calculate the wavelength of the electromagnetic wave using the Planck-Einstein's relation.

E = h × c / λ

λ = h × c / E

λ = (6.626 × 10⁻³⁴ J . s) × (3.00 × 10⁸ m/s) / 1.528 × 10⁻¹³ J

λ = 1.301 × 10⁻¹² m

The wavelength of this wave is equal to: D. [tex]1.301 \times 10^{-12}\;meter[/tex]

Given the following data:

Energy = [tex]1.528 \times 10^{-13} \;Joules[/tex]Plank's constant = [tex]6.626 \times 10^{-34}\;Js[/tex]Speed of light = [tex]3 \times 10^8\;m/s[/tex]

To determine the wavelength of this wave, we would apply Einstein's equation for photon energy:

Mathematically, Einstein's equation for photon energy is given by the formula:

[tex]E=\frac{hc}{\lambda}[/tex]

Where:

E is the energy. h is Plank's constant.[tex]\lambda[/tex] is the wavelength.c is the speed of light.

Making [tex]\lambda[/tex] the subject of formula, we have:

[tex]\lambda = \frac{hc}{E}[/tex]

Substituting the given parameters into the formula, we have;

[tex]\lambda = \frac{6.626 \times 10^{-34}\; \times \;3.0 \times 10^{8}}{1.528 \times 10^{-13} }\\\\\lambda = \frac{1.99 \times 10^{-25}}{1.528 \times 10^{-13} }\\\\\lambda =1.301 \times 10^{-12}\;meter[/tex]

Read more: https://brainly.com/question/9655595

Can someone answer these two separate questions pls ill give brainliest

Answers

The average speed

3. 89.7 m/min

4. 6.13 ft/min

Further explanation

Given

3. 1076 m in 12 min

4. 92 ft in 15 min

Required

average speed

Solution

3.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{1076~m}{12~min}[/tex]

This is my answer = 89.7 m/min

4.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{92~ft}{15~min}[/tex]

This is my answer = 6.13 ft/min


Na2SO3 + S -------> Na2S2O3


Answers

Answer:

Synthesis

Explanation:

A+B=C

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

F
19.00
Fluorine
Using the information on the figure above, report the atomic number and atomic mass of fluorine.

Answers

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

What do elements in a group on the periodic table have in common?

Answers

Answer:

They have similar chemical properties.

Explanation:

james madison test

The elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

What is periodic table?

The periodic table of  elements is defined as in which the classified all the non metals accordance with their properties in such a way that with similar properties are grouped.

Moosley arranged the elements in increasing order of their atomic number and observed that after a certain time of interval elements with same properties are repeated.

Therefore, elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

Learn more about periodic table, here:

https://brainly.com/question/11155928

#SPJ6

plzz help this is timed! true or false/Continental air masses are cold. Maritime air masses are hot.

Answers

Answer:

False.

Explanation:

A circuit is a path along which electric current flows. How would changing the battery in a circuit from 9 volts to 1.5 volts most likely affect the circuit? More electric charge would flow in the circuit. Less electric charge would flow in the circuit. The resistance in the circuit would decrease. The resistance in the circuit would increase.

Answers

Answer:

A wave passes from a solid to a liquid while remaining the same temperature.

The medium increases in temperature while remaining in the same phase.

The medium decreases in temperature while remaining in the same phase.

A wave passes from a liquid to a gas while remaining the same temperature.

AND less electric charge would flow in the circuit

The voltage is decreased

Explanation:

PLEZZ MARK ME AS BRAINLYEST PLEZZ!!

Changing the battery in a circuit from 9 volts to 1.5 volts would most likely result in less electric charge flowing in the circuit.

What is Ohm's law ?

According ohms law, the electric voltage is the product of current and resistance in the circuit. A lower voltage battery will have less electric potential energy available to move the charges, resulting in a lower electric current flow in the circuit.

The resistance in the circuit would not necessarily increase or decrease due to the change in the battery voltage. Resistance is a property of the components in the circuit, such as resistors, wires, and other devices that can impede the flow of current.

However, if the resistance of the circuit remains the same and the battery voltage decreases, the resulting electric current flow would also decrease according to Ohm's law (I = V/R), where I is the current, V is the voltage, and R is the resistance.

Find more on circuits:

https://brainly.com/question/27206933

#SPJ7

What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g

Answers

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

What is molar mass ?

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

Other Questions
Which of the following statements is true? a. A technological society has no impact on the environment. b. A technological society has a completely positive impact on the environment. c. A technological society has both a positive and negative impact on the environment d. A technological society has a completely negative impact on the environment. Please select the best answer from the choices provided Which of the following is necessary for individuals interested in researching and teaching positions? a. Job shadowing for 60 hours b. Completing an apprenticeship c. A doctoral degree d.Volunteering at local aquariums Company A Company B Market Value of Equity $250,000 $200,000 Market Value of Debt $600,000 $500,000 Cost of Equity 8% 10% Cost of Debt 2% 2% Tax Rate 35% 30% Based solely on their current weighted average cost of capital, which company should pursue an investment opportunity with an expected return of 5%? a) Neither Company A nor Company B b) Only Company B c) Only Company A d) Both Company A and Company B A child swings a tennis ball attached to a 0.626-m string in a horizontal circle above his head at a rate of 4.50 rev/s.a. What is the centripetal acceleration of the tennis ball?b. The child now increases the length of the string to 1.00m but has to decrease the rate of rotation to 4.00 rev/s. Is the speed of the ball greater now or when the string was shorter?c. What is the centripetal accleration of the tennis ball when the string is 1.00 m in length? PLSSSSSSSS HELPP Does this table of values represent a linear relationship? Explain your answer. A triangle has sides with lengths of 7 millimeters, 16 millimeters, and 18 millimeters. Is it a right triangle? pls help asap no trolls!! HELP 21 POINTSThe relationship between Virginia and its General Assembly is the same as that between a county and its- A. city councilB. ordinanceC. town managerD. board of supervisors Solve: log4(x - 5) = 1/2 Last Friday, 54 students did not eat breakfast at school and 126 students ate breakfast at school. What percent of thestudents ate breakfast at school yesterday?B30%A43%D70%54%- European countries set up colonies in Asia following the discovery of western and new eastern routes to these lands. What impact did these colonies have on the countries of Europe?Select one:a.These settlements were used as penal colonies--places to send the country's worst criminals.b.These settlements insured safe passage for merchants going further inland after landing in Asian ports.c.These settlements became homes for traveling merchants, who preferred to live outside Europe.d.These settlements paid taxes to their home governments, which made European countries and their monarchs richer. Compute the surface area of the portion of the sphere with center the origin and radius 4 that lies inside the cylinder x^2+y^2=12 Ming took a cab across town. His fare was $22, and he leaves an 18% tip. What is the total amount Ming pays the cab driver? Help please with number 11 Which delegate represented Virginia and was later called "The Father of the Constitution"? A. Benjamin Franklin B. James Madison C. Alexander Hamilton D. none of the above If the Federal government made a law that banned texting and driving, and forced all 50 states to adopt the law and a punishment for breaking that law, how might a Federalist react? Why? What are convergent boundaries? abraham has 16 blue marbles and 18 rwd marbles. if he wamts to place them in identical groups without any marbles left over Evaluate the following function for (3, -1):f(x, y) = 2x 3y + xy^2 A poker is a long thin tool used to move pieces of coal or logs burning in a fire. To be as safe as possible, the poker should be made from a material that Steam Workshop Downloader