Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

Answer 1

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1


Related Questions

The table below shows the initial and final masses of a radioactive material in a container.
Initial mass (in kilograms) 0.8
Final mass (in kilograms) 0.05
Based on the table, which of these conclusions is correct?
The half life of the material is three years.
The half life of the material is four years.
The mass of the material was 0. 1 kilograms after four half lives.
The mass of the material was 0.1 kilograms after three half lives.​

Answers

Answer: the half life of the material is four years

What is the sin of sex before marriage called?

Answers

The sin of sexual activity before marriage is often referred to as "fornication."

This term is used in many religious traditions, including Christianity and Islam, to refer to sexual activity between two individuals who are not married to each other.

Some other traditions may use different terms to describe this behavior, such as "premarital sex" or "adultery." It's worth noting that the concept of what constitutes a sin or immoral behavior around sexuality and sexual behavior can vary greatly across different religious and cultural traditions and belief systems.

It is important to note that this concept is based on religious and moral beliefs, and some people may have different views on it.

To learn more about fornication at

https://brainly.com/question/13744032?referrer=searchResults

#SPJ4

What is significant about the hoatzin?

Answers

Answer:

Hoatzin, (Opisthocomus hoazin), primitive chicken-sized bird of South American swamps, principally in the Amazon and Orinoco river basins. ... The hoatzin is the only bird with a digestive system that ferments vegetation as a cow does, which enables it to eat leaves and buds exclusively.

Explanation:

I hope this helps :)

For both groups of plants, what BEST describes the relationship between light intensity and rate of photosynthesis?
A. The rate of photosynthesis increases with light intensity, and might be limited by other factors such as water and temperature.
B. The rate of photosynthesis increases with light intensity, and it increases without limit.
C. The rate of photosynthesis is independent of light intensity, but may be limited by other factors such as water and temperature.
D. The rate of photosynthesis is at a maximum over a narrow range of light intensities.

Answers

Answer:

a

Explanation:

the rate of photosynthesis increases with light intensity

in a controlled experiment, which group expericences the test

Answers

answer: In a controlled experiment, the study population is often divided into two groups. One group receives a change in a certain variable, while the other group receives a standard environment and conditions. This group is referred to as the control group, and allows for comparison with the other group, known as the experimental group.

Explanation:

How are traits passed from generation to generation? Explain how dominant and recessive alleles interact to determine the expression of traits.​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. ... However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

The traits are passed from generation to generation through genes. The process is called heredity.

What is the passing of traits?

Heredity refers to the specific ways by which features or traits are passed down through generations via genes. Genes contain the instructions for producing certain proteins, which are responsible for an individual's unique characteristics.

Alleles are distinct variations of genes. Somatic cells contain two alleles for each gene, one from each parent of an organism.

An allele that is hidden or not expressed by an organism, on the other hand, can be passed on to that organism's descendants and expressed in a subsequent generation.

Therefore, traits are passed down from generation to generation via genes. The process is known as heredity.

To learn more about the passing of traits, refer to the link:

https://brainly.com/question/25558821

#SPJ2

An investigator wishes to use animals in an experiment that involves category B, C, and D activities performed on the same animal. How should the animal be categorized?A. Categories B, C, and D. B. Category B. C. Category C. D. Category D

Answers

When doing activities that fall under USDA pain categories B, C, or D on the same animal, the animals utilized in the experiment should be placed in USDA category D.

The level of pain that an animal employed in testing and research may experience is categorized using the USDA pain categories. These are the categories:

USDA B: The animal won't experience any type of suffering.

USDA C: The animal may experience sporadic little pain.

USDA D: Excruciating processes that medication will lessen.

USDA E: Excruciating processes that cannot be eased.

According to Category B, the animal won't experience pain. These animals are frequently utilized for breeding, which is a natural procedure that doesn't harm the animals.

In contrast to animals in category E, animals in category D undergo unpleasant or stressful operations and are given anaesthetics and other pharmacological agents to lessen or totally relieve the discomfort.

There is a rigid rule for these categories. Because the experiment will include USDA B, C, and D procedures, the animals must be classified according to the USDA category that will involve the most painful technique.

To know more about  categories

https://brainly.com/question/15061148

#SPJ4

How a river is formed?

Answers

River are formed from water moving from a higher elevation to a lower elevation, all due to gravity.

In general, rivers comes from starting point where water begins to flow this source is popularly known as a headwater. This source of headwater are said to generated from rainfall or melting of snow in mountains. They can also come up from the groundwater or at edge of a lake or large pond.

Other major sources include a rain falls on the land that mixed with ground water that  flows downhill into rivers and lakes and eventually towards the  seas. for example Himalayan Rivers are generated from the melting of snow and glaciers that melts through out the years.

To learn more about rivers , here

brainly.com/question/11260945

#SPJ4

What is the name for all the neurons in the central nervous system?
A. Axon neurons
B. Interneurons
C. Sensory neurons
D. Motor neurons

Answers

Answer:

B. Interneurons

Explanation:

The basic unit of the central nervous system is the neuron or the nerve cells. Billions of neurons allow the different parts of the body to communicate with each other via the brain and the spinal cord. A fatty material called myelin coats nerve cells to insulate them and to allow nerves to communicate quickly.

I think is B sorry if I’m wrong

Secondary sewage treatment is distinguished form primary sewage treatment by the: separation of the suspended solids from the liquid effluent. chlorination of the liquid effluent. aeration of liquid effluent following chlorination. removal of inorganic nutrients from the liquid effluent. addition of bacteria to process organic contaminants.

Answers

Secondary sewage treatment is distinguished from primary sewage treatment by the following:

Aeration of liquid effluent following chlorination.

Addition of bacteria to process organic contaminants.

Removal of inorganic nutrients from the liquid effluent.

Primary sewage treatment is the initial step in the treatment of waste water, and it typically includes the separation of the suspended solids from the liquid effluent. This can be achieved through sedimentation, mechanical screens, and other physical means to remove the larger particles from the waste water.

Secondary sewage treatment goes one step further by using biological processes to remove dissolved organic matter and inorganic nutrients from the liquid effluent. This is typically done through the use of microorganisms, which break down the organic matter in the waste water. Aeration is used to provide the microorganisms with oxygen, which is necessary for their growth and metabolism.

Chlorination can be used as a final disinfectant step following secondary sewage treatment to kill any remaining pathogens, but it is not a requirement of secondary treatment.

Learn more about sewage treatment:

https://brainly.com/question/27936084

Which of the following is the best example of a mechanistic understanding of a function?
a. We are self-aware so that we can recognize ourselves and distinguish ourselves from others.
b. The kidneys produce urine so that waste products, such as uric acid, do not build up in the blood.
c. Skeletal muscle cells contract when myosin heads attach to actin filaments and rotate, producing force.
d. Bones are strong so that they can support our body weight and protect delicate organs.

Answers

Myosin heads bind to actin and myosin and spin to produce force in the contraction of skeletal muscle cells. an illustration of how a function is understood mechanistically.

And what were the four skeleton types?

The body's framework is the skeleton. It helps give us form and serves as the base for other structures to attach to. The 206 bones that make up the skeleton may be divided into four groups: flat, long, short, and irregular.

What makes bone health important?

Bones are used by the body for a variety of functions, including as anchoring muscles, protecting organs, and creating structure. While it's important for children and adolescents to have strong, stable bones, there are things adults can do to preserve bone health.

To know more about skeletal visit

https://brainly.com/question/28187713

#SPJ4

Is a bicameral legislature made up of four bodies?

Answers

A bicameral system describes a government that has a two-house legislative system, such as the House of Representatives and the Senate.

A bicameral legislature is a type of legislature that is composed of two independent legislatures, chambers, or houses. Unicameralism, in which all members discuss and vote as a single body, is distinct from bicameralism. By 2022, only around 60% of national legislatures will be unicameral, compared to about 40% of bicameral legislatures.

The techniques used to elect or choose the members of the two chambers sometimes varied from jurisdiction to jurisdiction. This frequently results in the membership of the two chambers being significantly different.

To learn more about bicameral legislature please visit here:

https://brainly.com/question/20295264

#SPJ4

Determine which of the following sequences and structures represent part of mature eukaryotic mRNA.
- termination sequence
- 5'-UTR
- poly-A tail
- 3'-UTR
- start codon
- intron
- 5'-cap
- AAUAAA
- stop codon
- promoter

Answers

A portion of mature eukaryotic mRNA is represented by the sequences and structures of the stop codon poly-A tails 3'-UTR start codon 5'-UTR and AAUAAA.

What characterizes a eukaryotic?

Eukaryote refers to any species or organism that possesses a unique nucleus. A nuclear membrane encircles the nuclear of a multicellular organism, which is home to the distinct chromosomal structures that store the genetic material.

Do eukaryotes possess DNA?

In eukaryotic chromosomes, DNA is tightly wound around protein aggregates called histones. Genetic material is often far less abundant in prokaryotic cells than eukaryotic ones. Each human cell contains about 2m, or 3 million base pairs, of DNA, which must be compressed to fit on the inside of the nucleus. Eukaryotic cells include three distinct nuclear RNA polymerases, each of which transcribes a distinct class of genes.

To know more about eukaryotic visit:

https://brainly.com/question/29119623

#SPJ1

When an endospore germinates, it gives rise to two daughter cells called vegetative cells.
true/false

Answers

When an endospore germinates, it creates two daughter cells that are referred to as vegetative cells. Members of the genera Streptomyces are essential to the environment because of their capacity to break down a range of chemicals.

What does "germination" actually mean?

Germination is the action of seeds developing into new plants. First, the environment must support the seeds growing into new things. Usually, factors like the seed's depth, the water's accessibility, and the temperature all affect this.

What really is seed germination in biology?

An embryonic axis (usually the radicle) emerges from the seed coat at the end of a series of events that begin with hydration and constitute the process of seed germination.

To know more about germination visit:

brainly.com/question/15976369

#SPJ4

In sentence 3 (reproduced below), the writer wants to ensure that the connotation of the underlined word is appropriate to the context of the sentence. Adolescents have unique sleep patterns, and with an early school start, many are doggedly tired, leading to serious health and safety risks. Which of the following versions of the underlined word would best accomplish this goal?.
A. resolutely
B. relentlessly
C. chronically
D. steadily

Answers

Option C, The word "chronically" is the best option in this context as it conveys the idea that the tiredness faced by adolescents is a long-term and persistent problem. The word "chronically" implies that the tiredness is ongoing and consistent, which is a suitable description for the scenario described in the sentence.

The use of the word "chronically" in this context is appropriate as it emphasizes the fact that the tiredness faced by adolescents is not a temporary or occasional issue, but a long-term, persistent and ongoing problem.

This helps to convey the idea that the sleep pattern problems faced by adolescents due to an early school start are not a minor inconvenience, but a serious issue with potential health and safety risks.

For example, it can lead to poor academic performance, mood swings, lack of attention, an increase in risk-taking behavior, and even accidents. Therefore, the use of "chronically" in this sentence effectively highlights the gravity of the situation and the importance of addressing the problem.

To learn more about Adolescents at

https://brainly.com/question/9506316?referrer=searchResults

#SPJ4

PLEASE HELP!!! Iodine 131 has a half-life of about 8 days. How long will it take for the radiation of the isotope to go from 100 g to 12.5 g?

Answers

Answer:

After four half lives or 32 years, only 12.5 grams will be left.

Hope it helps :)

Claim 1: The sediment that formed the Great Plains came from the rock of the Rocky Mountains. Claim 2: The magma that formed the Rocky Mountains came from the rock of the Great Plains. Which claim is wrong Give evidence to refute/disprove the other claim

Answers

Claim 1: The debris that shaped the Great Plains originated from the igneous material of the Rocky Mountains. (correct)

Claim 2: The magma that produced the Rocky Mountains originated from the Great Plains' rocks. (incorrect)

Great Plains vs Rocky Mountains

The Great Plains were formed by sediment from the Rocky Mountains being transported and deposited by rivers and other geological processes. The sedimentary rock that makes up the Great Plains includes materials such as sand, silt, and clay that were worn down from the uplifted Rocky Mountains and carried eastward by streams and rivers.

The Rocky Mountains were formed by tectonic activity that caused the Earth's crust to uplift and create the mountain range. The mountains are primarily composed of igneous and metamorphic rock that formed deep within the Earth's crust, rather than from the sedimentary rock of the Great Plains.

There is no evidence that supports claim 2, the magma that formed the Rocky Mountains did not come from the rock of the Great Plains. The magma that formed the Rocky Mountains came from the Earth's mantle, which is beneath the crust and is composed of mostly solid rock. The Great Plains being sedimentary rock, formed from erosion and weathering of pre-existing rock.

Learn more about The Rocky Mountains here:

https://brainly.com/question/13438263

#SPJ4

With industrialized food production, for every one unit of energy put on the table in the United States, how many units of nonrenewable fossil fuel energy are required to produce it

Answers

In the United States, industrialized food production requires approximately 10 units of nonrenewable fossil fuel energy to produce 1 unit of energy put on the table.

This is because industrialized food production involves the use of heavy machinery, transportation of food from the farm to the distribution center, and the use of fertilizers, pesticides, and other chemicals to produce crops. All of these activities require energy which is typically sourced from nonrenewable fossil fuel sources.

Additionally, food production also requires energy for processing and packaging, which further increases the amount of energy required to produce 1 unit of energy put on the table. In conclusion, industrialized food production requires approximately 10 units of nonrenewable fossil fuel energy for every 1 unit of energy put on the table in the United States.

To learn more about pesticides visit:

https://https://brainly.com/question/24316938

#SPJ4

HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP

Which cross section best shows the formation of sedimentary rock?

Answers

Answer:

Option 1

Explanation:

The way the layers stack on each other is a obvious example of sedimentary rock.The sediments form layers on top of each other over time that hardens into rock creating layers. Geologists use these layers to determine how old something is or what time period a fossil was from. The sediments form layers on top of each other over time that hardens into rock creating layers.

The _____ of the respiratory system consists of a series of interconnecting cavities and tubes both outside and within the lungs that filter, warm, and moisten air and conduct air into the lungs.

Answers

The conducting zone of the respiratory system is a series of interconnected cavities and tubes outside and inside the lungs that filter, warm, humidify, and direct air to the lungs.

The respiratory system functionally he can be divided into two zones. The conducting zone (nose to bronchioles) provides the conduction pathway for inspired gases and the respiratory zone (alveolar ducts to alveoli) where gas exchange takes place.

The conducting zone consists of all structures that allow airways to enter and exit the lungs.

Nasal cavity, pharynx, trachea, bronchi, and most bronchioli. The conducting zone, which includes everything from the nose to the smallest bronchiole, allows air to enter and exit the lungs. The respiratory zone includes respiratory bronchioles and alveoli, which move breathing gases, oxygen and carbon dioxide, into and out of the blood.

For more information on conducting zone , visit :

https://brainly.com/question/13210491

#SPJ4

Why are the processes of crossing over and independent assortment important events during meiosis?

Answers

Each gamete has a unique DNA set because of recombination and independent assortment during meiosis. The resultant zygote has a special set of genes as a result.

A diploid cell, or homolog, the first stage of meiosis, has two copies of each chromosome. Each homolog now consists of two identical sister chromatids as a result of the cell's first DNA replication process.

Then, through homologous recombination, each set of homologs pairs with one another and exchanges genetic material, frequently resulting in physical connections (crossovers) between the homologs. The spindle machinery segregates the homologs into distinct daughter cells during the first meiotic division. The cells then move directly to a second division without a round of DNA replication in between.

Learn more about meiosis to visit this link

https://brainly.com/question/29383386

#SPJ4

As countries run out of their own fossil fuel reserves, they will have to purchase and export fossil fuels from other countries. Why is this an unlikely scenario?
O Countries that need more fuel don't export it.
O Countries don't need to purchase fossil fuels
O Countries will not run out of fossil fuels.
O Countries don't export fossil fuels.

Answers

Countries don't export fossil fuels. This is an unlikely scenario because most countries use their own fossil fuel reserves rather than exporting them.

What is fossil fuels?

Fossil fuels are organic substances sourced from ancient remains of plants and animals that have been transformed over millions of years by the process of heat and pressure. Common examples are coal, oil, and natural gas, which are primarily used to generate electricity, heat homes, and power vehicles. Fossil fuels are non-renewable and are a finite resource, meaning they will eventually be depleted. Burning fossil fuels also releases large amounts of greenhouse gases into the atmosphere, contributing to climate change. As a result, many countries are working to reduce their reliance on fossil fuels and transition to renewable energy sources such as solar, wind, and hydropower.

To learn more about fossil fuels
https://brainly.com/question/27511772
#SPJ1

What general information do we need to research further to investigate the origin of life on Earth?

Answers

The fossil record is the information we need to research to investigate the origin of life on Earth.

How do we know the origin of life on Earth?

The earliest evidence of life on Earth comes from fossils that are discovered in Western Australia which is about 3. 5 billion years ago. These fossils are the structures called stromatolites which are formed by the growth of a layer of single-celled microbes such as cyanobacteria.

The major source to know the history of life on earth is fossil records. Fossils are the remains of organisms that are present centuries ago. They form when an organism dies and is burry in dirt and is solidified by minerals.

So we can conclude that fossils are the information that shows the life of the earth.

Learn more about the earth here: https://brainly.com/question/15205710

#SPJ1

honeybee is considered as the most useful insect for human beings.justify this statement with any three reasons​

Answers

Answer:

Polinate plants, trees and foodThey give us honeybees are responcible of pollinating 15 billion of just US crops and 200 million pounds of UK crops. showing their contribution to agriculture

I need the answer asap

Answers

The answer is lysosome

Answer: lysosome

Explanation: Tay sach's disease impairs the functions of the lysosomal enzymes and causes the build up of GM2 ganglioside.

Tay sach's disease can also be called lysosomal disease due to the impairment it the lysosomal enzymes.


I neeed help I need a answer plsss help me out it’s due in 30mins

Answers

Answer:

number 3: bb

number 4:the evidence is shown in the pedigree chart since the square is colored in all the way, which means it is being affected in this situation

Explanation:

3 is bb because blindness is a recessive trait

Visit a fish farm in fish breeding season and note the following

Answers

The breeding season for fish varies depending on the species and the region.

1) Varieties of fish in the ponds: Depending on the fish farm, different varieties of fish may be present in the ponds. Common varieties may include tilapia, catfish, trout, and salmon.

2) Types of Ponds: The type of pond used will depend on the type of fish being raised. Common ponds include earthen ponds, tanks, raceways, and cages.

3) Feed Ingredients: The type of feed ingredients used in the farm will depend on the type of fish being raised. Common feed ingredients may include fish meal, soybean meal, corn, wheat, and other grains.

4) Production Capacity: The production capacity of the fish farm can be determined by the size of the ponds, the number of ponds, and the number of fish in the ponds. It can also be determined by the amount of feed used and the amount of time the fish take to reach market size.

What is a Fish farm?

A fish farm is a water-based aquaculture facility designed to breed, raise, and harvest aquatic animals such as fish, crustaceans, mollusks, and aquatic plants. Fish farms are usually located in coastal areas or near large bodies of water such as rivers, lakes, or oceans. They are used to produce food for both human consumption and for sale in the aquarium trade.

To know more about fish farms,

https://brainly.com/question/8565502

#SPJ1

Complete question:

Visit a fish farm in fish breeding season and note the following:

(1) Varieties of fish in the ponds.

(2) Types of ponds.

(3) Feed ingredients being used in the farm.

(4) Find out what the production capacity of the farm is​.

How would an early Persian windmill compare an early European windmill?

A. Persian windmill blades were vertical,like,propellers,white Europeans one were horizontal,like egg beaters.

B. Persian windmill blades were horizontal,like egg beaters,while Europeans one were vertical.

C. Persian windmills were made of discarded sails,while Europeans windmills were made of wood.

D. Persian windmills were made of stone,while Europeans windmills were made of wood.

Answers

Answer:

A is the correct answer

Explanation:

Persian windmill blades were vertical, like propellers, while European ones were horizontal, like egg-beaters. Explanation: ... The very first windmills featured with long vertical shafts with blades designed like rectangles who lived in ninth-century Persia. Six to twelve sails were produced of those windmills.

Explain changes in osmotic pressure that occurs when cells are placed in solutions of differing concentrations. Can you describe what happens to cells in different solutions:

Answers

Osmotic pressure relies upon simplest on temperature and the difference in the concentration throughout the membrane.

The osmotic pressure of a solution is proportional to the molar concentration of the solute debris withinside the answer. As quickly because the solute molecules will increase the osmotic strain of answer boom. Osmotic strain is laid low with attention and temperature. Concentration of solute and temperature every have an effect on the quantity of strain created through the motion of water throughout a membrane. Higher concentrations and better temperatures boom osmotic pressure. If a cell is positioned in a hypertonic solution, water will depart the cell, and the cell will shrink. In an isotonic environment, there's no  water movement, so there's no use withinside the length of the cell. When a cell is positioned in a hypotonic environment, water will input the cell, and the cell will swell.

To learn more about osmotic pressure check the link below:

https://brainly.com/question/10847614

#SPJ4

Give three ways the human body would change if all cells in the human body were the same.

Answers

Answer:

There are many different systems involved in when we exercise, the three main ones are the Respiratory system which is involved in breathing the circulatory system which is about circulation of blood around the body and finally the muscular system and finally the Muscular system which is about how we move.

Explanation:

Hope it helps u

FOLLOW MY ACCOUNT PLS PLS

Explanation:

I think they are

1-Bone deep: humans’ bones are in fact getting lighter and more frail. Owing to the sedentary nature of modern life, our bones have decreased in density and strength, most likely due a reduction in physical activity.

2-Gene change :Our genes are in a perpetual state of change, from one generation to the next. One major example of this is the rise in genes allowing for lactose tolerance. This upsurge is most likely due to the fact the majority of humans today drink milk all their lives. Historically, the enzyme that allows us to digest dairy turned off once we hit adulthood — when we were traditionally weaned off our mothers' breast milk.

3-body temperature.

Other Questions
What do capital resources increase? Can yall help with this I dont understand it The oblique circular cone has an altitude and a diameter of base that are each of length 12 cm. The line segment joining the vertex to the center of the base is the axis of the cone.What is the length (in centimeters) of the axis? During the chemical reaction that takes place inside a hot pack, is energy being released to the surroundings or taken in from the surroundings andwhy?Energy is taken in because all chemical reactions take in energy.Energy is released because the temperature of the surroundings increases.Energy is taken in because the temperature of the surroundings increases.Energy is released because all chemical reactions release energy.2 PLEASE HELPPPPPPSummarize Chapter 1-2 of Gilgamesh in abbreviations Individuals should participate in activities __________ to improve cardiovascular fitness. A. twice a day B. three to five days a week C. two to three days a week D. seven days a week Please select the best answer from the choices provided. A B C D Mark this and return What are the two types of measurements of angles? A sphere is inscribed in a cube with a volume of 8. cubic yards. What is the surface area of the sphere? How do you solve this how is sonia sotomayor and ha from inside out and back again similar? Help plz:)))Ill mark u Brainliest Plz I need the answer!!!:( Select the correct items from the list.You can classify some languages into multiple categories. Pick the categories in which the C++ programming language can be classified.ProceduralDeclarativeImperativeFunctionalLogic - BasedObject OrientedVisual4GChoose all that apply PLEASE HELP ME ASAP I'M BEING TIMED!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!The system of administering and exploiting colonies for the benefit of the home country is known as what?A. New ImperialismB. The Scramble for AfricaC. ColonialismD. Nationalism what is an equation of the line that passes through point (-6,-5) and is parallel to the line x + 5y=25 Which pair of functions have the same domain?A. f(x)= cos x and g(x)= tan x B. g(x)= tan x and f(x)= sec x C. f(x)= sin x and f(x)= sec x D. g(x)= tan x and f(x)= cot x Explain how fish and sharks breathe. what are some differences? In triangle ABC, angle A is 37 and angle B is 24*. Select all triangles which are similar to triangle ABC.D triangle DEF where angle Dis 37 and angle E is 24 triangle GHI where angle G is 37" and angle I is 34O triangle JKL where angle J is 35" and angle L is 125* triangle MNO where angle Nis 24* and angle E is 119O triangle POR where angle O is 24 and angle R is 30 What effect does refrain have in a formal poem?A. It emphasizes a point while also changing the point slightlyB. It creates a pattern of rhyming words that stick in a readers mindC. It reminds readers of the poem's title by repeating it over and overD. It connects a poem to poems written in earlier eras. A cylinder has a diameter of 8 inches and a volume of 128 cubic inches.What is the height of the cylinder? The rhetorical technique most used in this excerpt Is O parallelism O overstatement O ethos O shirt