Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?

Examine The Punnett Square Below. A Cross Between The Two Parents Results In 50 Offspring. How Many Of

Answers

Answer 1
From what I know a punnet square like that gives a 75 percent chance of the dominant trait to that offspring. I’m not entirely good at the subject but I hope that helps?
Answer 2
75 % ........................

Related Questions

Help me please! Do 1,2,3 by filling in the blank!!!!

and no website

Answers

The answer is Glucose

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?

a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance

Answers

Answer: Characteristics acquired during an organism's life are generally not passed on through genes.

Explanation:

The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.

What are acquired traits?

Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.

For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.

Therefore, the correct option is A.

Learn more about Traits here:

https://brainly.com/question/24886772

#SPJ6

WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)

Answers

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.

Answers

Answer:

The phenotypic ratio is 9:3:3:1

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

R is the dominant alleler is the recessive allele

Let us also assume that axial is the dominant trait, so

A is the dominant allelea is the recessive allele    

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.

Answers

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

What were the old women doing?
In Percy jackosn

Answers

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.

Can someone name and explain each lymph organ?

Answers

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Why does a mountain create a rain shadow on the other side of a mountain?

Answers

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

Other Questions
Back to the future} could be suitable for a science fiction movie- This statement is True or False? A person who evaluates a result of specialized test would work in which branch of healthcare?A. Diagnostic B. TherapyC. MedicalD. Nursing Round 6,584,003 to the nearest 10,000 Exercise 9-18 (Algorithmic) (LO. 5) In 2020, the CEO of Crimson, Inc., entertains 9 clients at a skybox in Memorial Stadium for a single athletic event during the year. Substantive business discussions occurred at various times during the event. The box cost $6,750 per event and seats 11 people. (The cost of a regular, nonluxury box seat at Memorial ranges from $50 to $100.) Refreshments served during the event cost $1,720 (and were separately itemized on the bill Crimson received). How much of these costs may Crimson deduct What can you most likely conclude after reading thepassage?APeople have mixed opinions about the use of cellphones in school.BSchools that ban cell phones provide moreopportunities for learning.CIf schools relax their cell phone policies, more teacherswill start texting.DMost students agree with the policy to ban cell phonesfrom school. Pls help me with the help I dont understand A block of density 8.9g/cm measures 5cm by 2cm, Given that the force of gravity is 10N/kg. Determine the maximum pressure Una piramide tiene como base un hexagono regular de 6cm de lado y la altura de la piramide es de 10cm . Calcula la apotema de la piramide (altura de las caras triamgulares) y su area total Paolo keeps track of his favorite baseball player's batting average, and notices the average is 0.4727272.... If his player has 55 at bats, what is the number of hits? PLEASE HELP FAST Part A: Find the value of c that will result in a perfect square trinomial.x2 + 18x + c = 25 + c Help me plz?.,......................................................... NEED NOW ALREADY PAST DUEExplain some of the ways that an author may choose to arrange an informational text.What are some steps to follow when writing a summary of a text?The first sentence of a summary should always include what two items?How can two authors of nonfiction express similar opinions in different ways?What is meant by a writer's tone? How may an author establish a tone?What are some spelling rules for adding a suffix to a word that ends in the letter y?Summarize the rules for adding apostrophes to show possession. What is the difference between an inhabited and uninhabited territory?1: Inhabited territories have a permanent population, and uninhabited territories do not.2: Uninhabited territories have a permanent population, and inhabited territories do not.3: Inhabited territories are claimed by more than one country.4: Uninhabited territories are claimed by more than one country. The algebraic expression for the sum of 5 and g? 10,045 rounded to the tens place translate plsNo somos extraos para amarTu conoces las reglas y yo tambinUn compromiso total es lo que estoy pensandoNo obtendras esto de ningn otro chicoSolo quiero decirte como me sientoTengo que hacerte entenderNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteNunca te har llorar, nunca te dir adisNunca dir una mentira y te lastimarNos conocemos desde hace tanto tiempoTe duele el corazn pero eres demasiado tmido para decirloPor dentro, ambos sabemos lo que ha estado pasandoConocemos el juego y lo vamos a jugarY si me preguntas como me sientoNo me digas que eres demasiado ciego para verNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteNunca te har llorar, nunca te dir adisNunca dir una mentira y te lastimarNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteNunca te har llorar, nunca te dir adisNunca dir una mentira y te lastimarOoh, te rindoOoh, te rindo(Ooh) Nunca me rendir, nunca me rendir (Te rendir)(Ooh) Nunca me rendir, nunca me rendir (Te rendir)Nos conocemos desde hace tanto tiempoTe duele el corazn pero eres demasiado tmido para decirloPor dentro, ambos sabemos lo que ha estado pasandoConocemos el juego y lo vamos a jugarSolo quiero decirte como me sientoTengo que hacerte entenderNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteNunca te har llorar, nunca te dir adisNunca dir una mentira y te lastimarNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteNunca te har llorar, nunca te dir adisNunca dir una mentira y te lastimarNunca te rendir, nunca te decepcionarNunca voy a correr y abandonarteAcabas de tener a rick enrollado Guys pls help me!!!!!! Why do scientists carry out experiments?A.Because scientific knowledge is based on observationsB.Because scientific knowledge is full of untested theoriesC.Because scientists like to control variablesD.Because scientists like to work in labs Samantha walks a total of 3/4 miles to get to and from school each day write an addition expression that can be used to find the total numbers of miles that has Samantha walk to and from school over 2 days Then evaluate the expression Which of these is the Federal Trade Commission (FTC)?A. cartelB. consumer advocacy groupC. government contractorD. competition regulator Steam Workshop Downloader