Jane and Lia rode their bikes to the park. What is the compound subject in the sentence

Answers

Answer 1

Answer:

and Lia is the compound

Explanation:

the reason for this is because if you were to take out and Lia and their it would be a sentence that made sense by itself.

Answer 2

Answer:

Jane and Lia

Explanation:

A compound subject is two or more individual noun phrases coordinated to form a single, longer noun phrase.


Related Questions

4. PART A: Which of the following statements best
summarizes the effect the imagery has on the overall
poem?
O A The imagery of death and battle contributes to
the central theme of war and how it changes not
only the physical landscape but that of people as
well.
B The imagery presented, detailing rich earth and
plant life, contributes to the idea of nature as
cyclical, that life and death have a purpose in said
circle.
oa The idealized imagery contributes to the central
theme of faith, for it conjures ideas of heaven and
the afterlife.
OD The imagery of beautiful nature (specifically of
idyllic English nature) contributes to the poem's
sense and tone of devotion to England.

Answers

Answer:

D

Explanation:

Because it is

Provide three details from "Journal of the First Voyage to America" that only an eyewitness or participant could provide. Analyze Columbus's purpose for sharing each of the details you have listed in the previous question.

Answers

Answer:

1. "Here follow the precise words of the Admiral: “As I saw that they were very friendly to us, and perceived that they could be much more easily converted to our holy faith by gentle means than by force, I presented them with some red caps, and strings of beads to wear upon the neck, and many other trifles of small value, wherewith they were much delighted, and became wonderfully attached to us."

2.  "I do not, however, see the necessity of fortifying the place, as the people here are simple in war-like matters, as your Highnesses will see by those seven which I have ordered to be taken and carried to Spain in order to learn our language and return",

3.  "They very quickly learn such words as are spoken to them".

Explanation:

Christopher Columbus was sent by the Spanish Royal government which was a Christian domain to expedite foreign lands so that they can be converted and so that they can expand their trade. The details above could only have been observed by eyewitnesses.

1. The first excerpt showed that the Admiral noticed that the people were friendly. This might have been narrated by Columbus to show how easy it would have been to convert the natives to Christianity.

2. Columbus described the people as being simple in war-like matters to make the King understand that conquering these people would be an easy task.

3. The ease with which they learned the language was noted to relay to the King how easy it would be to teach them their own language which would further help in their colonization.

USING SEMICOLONS AND COLONS CORRECTLY Correct the punctuation in the following sentences by re-writing the sentence, adding semicolons and colons where they are needed and by changing other punctuation and capitalization as needed.
Example
1.
The following items were among those rationed in the United States during World War II coffee, cars, sugar, and tires.


Corrected version: The following items were among those rationed in the United States during World War II: coffee, cars, sugar, and tires.

Pastor Elrod’s sermon today was based on Matthew 5 3, which is the opening verse of the Sermon on the Mount.

Answers

Answer:

Pastor Elrod’s sermon today was based on Matthew 5:3, which is the opening verse of the Sermon on the Mount.

Explanation:

Answer:

just use the

Example for every answer i got a 100 percent :) hope this help

Explanation:

How does Eliezer's father avoid being selected?

Answers

Answer:

How does Wiesel's father avoid being "selected" at Gleiwitz and why does Wiesel run after him to the left? When his father was selected Eliezer is able to inch his way through the lines and bring him back to the "right" area where the people that were not selected were waiting.

Explanation:

And I amend the prince and I will

my brother..... a new job a week ago(got... Get.. Has got) ​

Answers

Answer:

has got

Explanation:

My brother has got a new job a week ago

Craft and structure: what is the meaning of the word rich in paragraph 12

Answers

Answer: (I don’t have the paragraph because you didn’t send it so I’ll just put the definitions of rich.)

Rich - a person with a lot of money

Rich - the soil was rich with fertilizer, meaning it had plenty.

Why do immigrants struggle with employment?

Answers

Answer: How serious are problems for imigrant's? Language barriers do pose a threat in potentional jobs to be hired for because many require english as a job. Employment opportunities are so difficult to grab as a immigrant because many are skeptical and don't see them with high value in a country that mostly speaks english and very few speak english.

Explanation:

Am I right??? Plz let me know!!!!

Answers

Answer:

yes

Explanation:

you are correct

Answer:

yes

Explanation:

i just did this like yesterday.

PLEASE ANSWER QUICKLY
Which sentence indicates that the narrator's assumed identity
a Louisville civilian is successful?



A) “That afternoon I was went out again to sell some goods to the soldiers.”


B) “The person that was considered by our troops a through Union man since he had taken the oath of allegiance to the Federal Government.”


C) “at last I expressed a desire to enter the confederate service.”


D) “after a long conversation and much planning, we at last decided that I should go through our lines the next night with a person known to the merchant.”

Answers

The answer is b hehehejsns

Excerpt from Stuff Matters
By Mark Miodownik
At some point humans made the discovery that would end the Stone Age and open the door to a seemingly unlimited supply
of the stuff. They discovered that a certain greenish rock, when put into a very hot fire and surrounded by red-hot embers,
turns into a shiny piece of metal. This greenish rock was malachite, and the metal was, of course, copper. It must have been
the most dazzling revelation. Suddenly the discoverers were surrounded not by dead inert rock but by mysterious stuff that
had an inner life. They would have been capable of performing this transformation with only a few particular types of rock,
such as malachite, because getting it to work reliably depends not just on identifying these rocks but also on carefully
controlling the chemical conditions of the fire. But they must have suspected that those rocks that didn't work, that remained
obstinately rock-like however hot the fire became, had hidden secrets. They were right. It's a process that works for many
minerals, although it would be thousands of years before an understanding of the chemistry required (controlling the
chemical reactions between the rock and the gases created in the fire) led to the next real breakthrough in smelting. In the
meantime, from around 5000 BC, early metal smiths used trial and error to hone the process of the production of copper. The
making of copper tools initiated a spectacular growth in human technology, being instrumental in the birth of other
technologies, cities, and the first great civilizations. The pyramids of Egypt are an example of what became possible once
there were plentiful copper tools. Each block of stone in each pyramid was extracted from amine and individually hand-
carved using copper chisels. It is estimated that ten thousand tons of copper ore were mined throughout ancient Egypt to
create the three hundred thousand chisels needed. It was an enormous achievement, without which the pyramids could not
have been built, however many slaves were used, since it is not practical to carve rock without metal tools. It is all the more
impressive given that copper is not the ideal material for cutting rock since it is not very hard. Sculpting a piece of limestone
with a copper chisel quickly blunts the chisel. It is estimated that the copper chisels would have needed to be sharpened
every few hammer blows in order for them to be useful. Which sentence shows that the human civilization has been positively affected by the discovery of copper A) in the meantime from around 5000 BC early metalsmith‘s use trial and error to hell in the process of the production of copper be it is estimated that 10,000 tons of copper or for mine throughout ancient Egypt to create the 3000 chisels needed see the making of cover tools initiated a spectacular grown and human technology being instrumental in the birth of technologies cities in the first great civilizations de it is estimated that the copper chisels would have needed to be sharpened every few hammer blows in order to them to be useful

Answers

Answer:

the making of cover tools initiated a spectacular grown and human technology being instrumental in the birth of technologies cities  

Explanation:

The text shows how the manipulation of fire and malachite for the creation of copper was very important for the evolution of societies and the construction of modern and technological cities. As seen in the text, the civilization of ancient Egypt, one of the most successful and modern of antiquity, depended heavily on the manipulation of copper to succeed in its works, just as this element was important for the manufacture of tools and objects .

Of course, this manipulation was not born overnight and it took a process that took years of trial and error, capable of developing the knowledge necessary to use this tool.

The answer to this question please

Answers

Answer:

...

Explanation:

6.

Write an accurate summary of the story Shadmock

Answers

Answer: No

Explanation:

No

_______ he did to study for the final exam must have been helpful; his grades improved from a B to an A.

Answers

I'm confused on what ur trying to figure out. is there a photo I can see

Answer:

Whatever

Explanation:

Its the answer

what happen if you don't make enough electricity? what happens if you make too much?

Answers

A natural consequence of overusing energy is increased costs for you. This can come in the form of fuel and energy bills; you will be paying more without an appreciable return on your investment. You may also risk lowering the expected lifespan of appliances and other electronics.

Find at least two figurative language

Answers

Answer:

1) music can teach you many lessons ( its inanimate, it cant do that )

2)music travels through my body ( also not possible proving that these are both figurative language )

Explanation:

He’s correct I took the test.

Find the subject(WILL BIVE BRAINLIEST TO FAST AND BEST ANSWER)

The magazine publisher choose bob picture for this months cover.

Answers

Answer:

The subject is he was a good citizien

Explanation:

The subject to this statement is that Bob was good person in the community. He helped people and contributed and it made the magazine want to do a cover of him.

Was blanche’s fate fair?

Answers

Answer:

her death was unfair

hope this helps and have a nice day

Review the metaphor from “The Golden Cat.” And when he strokes the Earth’s green fur He makes the Fields and Meadows purr. Which statement best describes the meaning of this metaphor? Both the sun and the grassy places on the earth have catlike qualities. Both the sun and the grassy places on the earth are living beings. The grassy places on the earth love being in the sun. The grassy places on the earth have their own special sound

Answers

Answer:

the answer is," the grassy places on earth love being in the sun.".

Explanation:

I took the test

The grassy places on the earth love being in the sun is the statement best describes the meaning of this metaphor. Hence, option C is correct.

What is the “The Golden Cat"?

Blink through the gate after moving the Whale Oil out of the way. Take cover among the buildings on your right as you arrive, then traverse the roofs to the Captain's Chair Entrance.

There is a Bone Charm within; take it. Once you reach the top floor, use the door to access The Golden Cat. It may be found on the desk in Madame Prudence's office at the Golden Cat during the House of Pleasure assignment.

In the basement of the Golden Cat, there is another replica on a wall hook in the room that is closed off from the steam room. Corvo has a variety of options for saving Emily. The simplest is to blink to the side of the walkway.

Thus,  option C is correct.

For more information about “The Golden Cat", click here:

https://brainly.com/question/14361255

#SPJ5

how old os ceacer please answer​

Answers

Answer:

55

Explanation:

julius Caesar was born on July 13th 100 BC. He was assassinated on the Ides of March (March 15th) 44 BC. Meaning he was 55 years old and four months shy of reaching 56

What are 2 ways Harrison broke the laws of the government in the short story “Harrison Bergeron” by Kurt Vonnegut?

Answers

Answer:Yup,” said George. He tried to think a little about the ballerinas. They weren’t really very good – no better than anybody else would have been, anyway. They were burdened with sash-weights and bags of birdshot, and their faces were masked, so that no one, seeing a free and graceful gesture or a pretty face, would feel like something the cat drug in. George was toying with the vague notion that maybe dancers shouldn’t be handicapped. But he didn’t get very far before another noise in his ear radio scattered his thoughts.

Explanation:

1. Did the student expand his or her topic from the four-source essay to the six-source essay? Or did the student narrow his or her topic from the four-source essay to the six-source essay?

Answers

The student expanded the topic

Read this sentence from Tuesday, April 11, 1944, in Anne Frank: The Diary of a Young Girl. Of course Henk and Miep were greeted with shouts and tears. How do the words shouts and tears affect the tone of the passage? They hint at recklessness because the noise can lead to their discovery by burglars. They contribute to a tone of relief because the group is receiving their friends. They show anger because the group wants to blame someone for their fears. They reflect sadness at the fact that the intruders have been found too late to prevent the burglary.

Answers

Answer:

B) They contribute to a tone of relief because the group is receiving their friends.

Explanation:

1- I have read this story many times to know this tone

2- I got 100% on my quiz

3- I like to write and because of it, I was able to recognize this tone of voice very easily

4- I did my research to make sure it was true.

The words shouts and tears affects the tone of the passage because:

B. They contribute to a tone of relief because the group is receiving their friends.

According to the given sentence, we can see that there is a narration about the way the group of friends received their friends as they came to visit them.

As a result of this, we can see that there is a use of the words "shout" and "tears" which was used to describe the way Henk and Mlep were welcomed by their friends when they arrived.

This shows a tone of relief because the group is receiving their friends.

Therefore,  the correct answer is option B

Read more here:

https://brainly.com/question/18222130

1. Describe a time in the discussion when you asked or answered a question by using information you learned while you were preparing for the discussion. (I just need a straight up answer)

Answers

One time when I was doing a discussion, We were the second group to go. I waited and listened to the first groups reasoning and used that to back up my arguing. By using their information I was able to create questions for the discussion.

Answer:

one time we were at school we were the last grup to go so me and my group got some of the other group information and add it to ours

Explanation:

1. What is dance?
B. Review: Answer the following questions in a separate sheet.
2. What benefits you can get from dancing? How can you be benefited from
dancing?
3. What are the types of dances? How do classify these dances?
4. Why do some people consider dance as one of the best exercises?​

Answers

answer:

Dance is the movement of the body in a rhythmic way, usually to music and a given space in time, for the purpose of expressing an idea or emotion, releasing energy or simply taking delight in the movement itself.

Which statement most accurately describes the issue(s) in this paragraph?
(A) The paragraph has punctuation, grammatical, and spelling errors.
(B) The paragraph is choppy and in need of transitions.
(C) The paragraph lacks supporting details.
(D) The paragraph contains sentences that wander from the main topic.​

Answers

Answer:

I think the correct answer is option is D : the paragraph contains sentence that wander from the main topic.

The statements that most accurately describes the issue(s) in this paragraph are-

(A) The paragraph has punctuation, grammatical, and spelling errors.

(B) The paragraph is choppy and in need of transitions.

Why option A and B are correct options?

The paragraph that is given in the question abruptly moves from one point to another without proper explanation. The reseach sources are also not provided to support the main claim of the argument.A few lines are not properly written and lack correct usage of punctuation and grammar. This also includes the tone of the paragraph which is informal sometimes. It should be written in formal sentences.

Thus, the grammatical errors and choppy sentences describe the issues in this paragraph.

Learn more about grammatical errors from here-

https://brainly.com/question/19575157

#SPJ2

I need help please. The picture is passage.

Q: It can be inferred that the author of Passage 1 would be more likely than the author of Passage 2 to do all of the following except:

A. Live in the country
B. Sit outside a house on a large porch
C. See him/herself as the greatest race
D. Live in a wood home with a veranda

Answers

Answer:

A

Explanation:

to live a beautiful life

A cake was being baked by my mother continuous tenses​

Answers

Answer:

My mother was baking a cake.

Answer:

Explanation:

Past continuous

A cake was cooking by my mother.

Present continuous

A cake is baking by my mother.

(you didn't say what kind of continuous)

Because the earth is always rotating
Is this a independent clause

Answers

Answer: No, because "Because" makes it not an independent clause.

How do both Laura and Maurice benefit from their relationship

Answers

Laura learns that she needs to be a good role model for Maurice. Maurice gets to feel more loved and special from the kindness Laura provides

The correct response is - Laura discovers that she must serve as a positive role model for Maurice. Laura's generosity makes Maurice feel more unique and appreciated.

What is Maurice?

Clive Durham, a fellow Cambridge student, and Maurice fall in love and spend three happy years together before Clive chooses to be married and have a "normal" life. As a result, Maurice becomes irrational, experiences a great deal of anguish, attempts to "heal" himself, and eventually finds love in a gamekeeper named Alec Scudder.

When Clive admits to Maurice that he is attracted to him sexually, Maurice discovers that he is gay when he starts to feel the same way. To protect Clive's reputation, they begin a strong but discreet relationship. Eventually, though, their romance ends, and Clive marries Anne (Phoebe Nicholls).

To read more about Maurice, refer to - https://brainly.com/question/18410578

#SPJ2

What do the girls do to Mary toward the end of the Act and how does
Mary react to this?

Answers

Answer: They pretend that her spirit is coming to get them, that she is herself doing some bewitching. Mary tells them to stop it, but when they don't, she ends up breaking down and joining them.

Explanation:

The girls do to Mary toward the end of the Act this was a major happening and they pretend that it was witchcraft.

What is a crucible?

They play the part of her ghost attacking them and act as though she is the one executing the enchantment. Mary tries to persuade them to stop, however when he does not really, she finally gives in and joins her.

This definitely frequently relates to a specific court proceeding. Both interpretations clearly relate to the game's title. The Salem witch trials eventually served as a smelter for the locals—a period of intense testing and purification.

Although the trial includes some sequences in the genuine courts, the allegory goes beyond those events.

Learn more about crucible, here:

https://brainly.com/question/355513

#SPJ2

Other Questions
In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants which part of the government according to the constitution, should be made up to two representatives per state? (Apex) A. the senate B. congress C. the Articles of confederation D. the House of representatives (4x5)+6x4+(9-3) (5+6) show your work Help people. Im so tired and I cant even guess what it can be !