Jezebel is planning a party at the skating rink. The cost for each person attending is $3.50 for skate rental and $5.00 for food. Jezebel cannot spend more than $300. Which inequality could be used to find the greatest number of people, p, that can attend?

Answers

Answer 1

Answer:

The inequality that could be used is 8.50p≤300 and the greatest number of people that can attend is 35.

Step-by-step explanation:

From the information provided, you can write an inequality where total cost for people attending at the party should be less than or equal to $300:

3.50p+5.00p≤300

8.50p≤300

Now, you can solve for p:

p≤300/8.50

p≤35

According to this, the answer is that the inequality that could be used is 8.50p≤300 and the greatest number of people that can attend is 35.


Related Questions

What is the greatest common divisor of 6 and 4?

Answers

Answer:

2 i think

Step-by-step explanation:

Answer:

2

Step-by-step explanation:

2 is the highest number that can divide betwwen 6 and 4.

If e^5x = k, where k is any positive number, then what is the value of x?
A. lnk/ln5
B. ln(k/5)
C.1/5*ln k
D. 5 * 1/ln k

Answers

[tex]e^{5x}=k\implies\ln(e^{5x})=\ln(k)\implies\boxed{x=\ln(k)/5}[/tex]

Hope this helps.

I need help on this!!

Answers

Answer: you would devide

not sure

Step-by-step explanation:

9(m - 3) + 3m = 7m + 43​

Answers

Answer:

m=14

Step-by-step explanation:

Isolate the variable by dividing each side by factors that don't contain the variable.

Answer:

M=14

Step-by-step explanation:

So distribute first

9m-27+3m=7m+43

Combine like Terms

12m-27=7m+43

Subtract 7m on both Sides

5m-27=43

Add 27 on both sides

5m=70

Iso,ate variable by dividing 5 on both sides

m=14

quired 1) Write in expanded form: 43 * Your answer​

Answers

40+3


40 in tens place and 3 in ones place hope it helps

Simplify Using Distributive Property
-6(2a + 8)

Answers

Answer:

-12a - 48

Step-by-step explanation:

you do -6 times 2a which is -12a then you do -6 times 8 which gives you -48 so you put -12a - 48

since the 48 is a negative we would just put a minus sign instead a plus. If it was a positive 48 we would put a plus sign buts its not so we put a negative.

[tex]\huge\boxed{\mathcal{HELLO!}}[/tex]

The distributive property states that

a(b+c)=ab+ac (we multiply a by everything inside the parentheses)

-6(2a+8)

-12a-48

[tex]\huge\boxed{Answer:-12a-48}[/tex]

Hope it helps!

[tex]\bold{Enjoy~your~day!}[/tex]

Given the point and its image, determine the scale factor.
B(2,5) B'(1,2.5)
1/3
1/2
2
0 1

Answers

Answer:

it would be 2

Step-by-step explanation:

Simplify and round the expression below. C isn’t necessary to answer

Answers

11.3057558 is the answer when you multiply/add/subtract it all.

for the equation x + y = 3. How many possible values for x are there if x and y are both whole numbers?

A.2
B.3
C.4

Answers

Answer:

A

Step-by-step explanation:

Because it is 2+1 and 3+0, those are the only solution, therefore A is correct

Answer: C) 4

======================================================

Explanation:

The set of whole numbers is {0, 1, 2, 3, ...}

So we include 0 and any positive number that doesn't have decimal or fractional components to it. Negative values are not included.

If we plug in x = 0, then x+y = 3 solves to y = 3If we plug in x = 1, then x+y = 3 solves to y = 2If we try x = 2, then x+y = 3 solves to y = 1Lastly, x = 3 leads to y = 0

Whatever you pick for x, the y value must add to it to get 3. Both x and y must be numbers from the set of whole numbers.

There are four cases shown in the bullet points above, so we have four different solutions. We can't move onto x = 4 because the y solution would be y = -1, but -1 is not in the set of whole numbers.

which of the following is equivalent to 2/3 divided by 5/6 ?

Answers

Answer:

.8  or 8/10 or 4/5

Step-by-step explanation:

Pls help me ASAP PLS PLS PLS PLS

Answers

Answer:

[tex]g^{-1}[/tex] (x) = 8x + 48

Step-by-step explanation:

let y = g(x) and rearrange making x the subject, that is

y = [tex]\frac{x}{8}[/tex] - 6 ( add 6 to both sides )

y + 6 = [tex]\frac{x}{8}[/tex] ( multiply both sides by 8 )

8(y + 6) = x , distribute

8y + 48 = x

Change y back into terms of x with x = [tex]g^{-1}[/tex] (x) , thus

[tex]g^{-1}[/tex] (x) = 8x + 48

The cost of a gallon of gas
changed from $2.15 to $2.68.

Answers

Answer:

whats the question or answer you're looking for?

Step-by-step explanation:

So it says change the following fractions and mixed numbers to decimal numbers
2 1/6
Help explain or like do the work cuz this due tomorrow plzzz

Answers

Answer:

2.16666666667 or rounded to 2.17

Step-by-step explanation:

first you have to change the mixed number to an improper fraction which would be 13/6 and then divide the numerator by the denominator

8c - 6c + 14 = 12 what is c

Answers

Answer:

c= -1

Step-by-step explanation:

combine like terms

2c+14=12

subtract 14 from both sides

2c= -2

divide 2 on both sides

c= -1

HOPE THIS HELPS!!

Any help is good but kinda hard

Answers

Answer: 65+75+2x=180

Solve that ^

Step-by-step explanation:

So you know a triangle adds up to 180 so put it all in an equation (please mark this brainliest)

Help Quick! This is a fraction problem by the way.

Multiply.

1 2/3 x 6

Answers

Answer:

10

Step-by-step explanation:

Answer:

the answer is 24

Step-by-step explanation: first you simplify 12/3 which is 4/1 and then you multiply 4 by 6 which is equaled to 24.

angela buys 12 cans of soda for $5.40.what is the unit rate for each can of soda

Answers

Answer: $0.45

Step-by-step explanation: $5.50/ 12= $0.45

∆JKL=∆QRS
what is m<Q?
enter you answer In the box

Answers

Answer:

38 degrees

Step-by-step explanation:

The two triangles are congruent, so do the following

1. Add 37 and 105 together

2. 37 + 105 = 142, subtract this from 180

3. This would amount to 38. So yeah.

I am having a lot of struggles please help

Answers

Answer: x = 23

∠DBC = 23°

∠ABC = 157°

Step-by-step explanation: A straight line is 180°, which means that ∠DBC and ∠ABC must equal 180°.

180 - 19 = 161

23 × 6 = 138

138 + 23 = 161

If x = 23°, then ∠DBC is 23°.

For ∠ABC, (6(x) + 19°

6(23) + 19°

6 × 23 = 138

138 + 19 = 157

∠ABC = 157°

Which sum or difference is equivalent to the following expression?

Fraction: 5 minus 3 x over 5
A. 1 + three-fifths
B. 1 + start fraction 3 x over 5 end fraction
C. 1 – start fraction 3 x over 5 end fraction
D. 25 – 15x

Answers

Answer:

Which sum or difference is equivalent to the following expression?

5 minus 3 x over 5

A. 1 + three-fifths

B. 1 + 3 x over 5

C. 1 – 3 x over 5 *My answer

D. 25 – 15x

I took the test and I got it right

Please answer

-3x - x + 2 <-14

Answers

Answer:

x > 4

Step-by-step explanation:

Answer:

x  >  4

Step-by-step explanation:

What is 15/8 - 1 subtracting fractions

Answers

Answer:

I believe that it is .875 or 7/8 but im not sure

Step-by-step explanation:

help please i want help please

Answers

don't listen but i'm gonna go with the third one

Which value of x makes the equation 1.25(4x+2)=32.5

Answers

Answer: x=6

Step-by-step explanation:

a=4, b=2,c=-1 find value of a-b+c

Answers

Answer:

1

Step-by-step explanation:

Substitute the value of the variable into the expression and simplify.

4-2-1=1

Answer:

1

Step-by-step explanation:

a-b+c

=4-2+(-1)

=2-1

=1

The question is in the picture.

Answers

Pretty sure it’s the one on the top left corner

Answer:

it's the bottom left one

I hope this helps

What is an equivalent expression to 9(c+5)=

Answers

Answer:

9 times 5 + c

Step-by-step explanation:

Will mark be marked bralest if right

Answers

Answer:

b

Step-by-step explanation:

The school store collected $12.00 from selling pencils and a total of $42.00 from selling pencils and pens. If pen cost $0.75 each, how many were sold?

Answers

Answer:

The answer is D

Answer is 40 pens were sold

Write the coordinate of A’ after A (5,3) got reflected over the x-axis.

Answers

Answer:

  A'(5, -3)

Step-by-step explanation:

Reflection over the x-axis changes the sign of the y-coordinate:

  (x, y) ⇒ (x, -y)

  A(5, 3) ⇒ A'(5, -3)

Other Questions
78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity?