Marine Biology Please Answer and Explain
Is Gause’s Principle accurate? Explain why or why not.

Answers

Answer 1

Gause’s Principle is accurate because he describes that two species with the same niche cannot exist in the same habitat  which is true.

What is a Niche?

This is a term which is referred to as a place or position that's particularly appropriate for someone or something, especially due to being very specific and different from others.

Gause’s Principle however states that two species with the same niche cannot exist in the same habitat  which is true. This is because their coexistence will lead to a high degree of competition which could lead to a decrease in their survival rate in the ecosystem.

Read more about Niche here https://brainly.com/question/728057

#SPJ1


Related Questions

Quorum-sensing contributes to the ability of bacterial colonies to congregate into nearly solid masses which act as barriers to effective decontamination and sterilization called:

Answers

Biofilms are formed when bacteria congregate into a nearly solid mass. This occurs when bacteria use quorum sensing to communicate with each other and create pathways for cells to attach to and form a matrix.

The matrix shields the cells from external forces and helps to protect the bacteria from antibiotics, desiccation, and extreme temperatures. Biofilms can form on just about any surface, including medical and surgical instruments, water pipes, and even on the surfaces of plants and animals.

The formation of biofilms makes it difficult to decontaminate and sterilize, since the bacteria are protected within the matrix and can withstand harsh chemicals and extreme temperatures. Biofilms are also highly resistant to antibiotics, making them difficult to eradicate.

To learn more about antibiotics visit:

https://brainly.com/question/10868637

#SPJ4

can some one help me ill give more points if its right. ill give like 50

Answers

Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.

Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway

Answer:

Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.

Explanation:

Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.

What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses

Answers

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

What are genes and what do they do?

A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.

What are the four primary roles of genes?

Gene functions include:

Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.

Learn more about  gene functions to visit this link

https://brainly.com/question/8334911

#SPJ4

Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

Many viruses specifically methylate protective genes, thus enhancing viral infectivity.

Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.

Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.

Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.

Answers

Answer:

Yes they are wrong

Explanation:

I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.

How has the world population changed in the last 200 years?

Answers

The world population has greatly increased in the last 200 years. Hope this helps :-)
the world population has increased and more humans are being born every year

8. The table below shows the number of generations required to produce white
butterflies through natural selection Calculate the mean, or average, number
of generations it takes to produce white butterflies.

Answers

Answer:

mean is  44.8

median is 36

Range is 32

Explanation:

hope it helps  

stay safe love u

btw can i get brainliest

What happens in insertion mutation?

Answers

An insertion mutation changes the DNA sequence by adding one or more nucleotides to the gene.

An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and frameshift mutations.

Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.

To learn more about mutation , here

brainly.com/question/17130462

#SPJ4

in details the steps for blood clotting in response to an injury

Answers

The process of blood clotting, also known as coagulation, is a complex series of steps that the body undergoes in response to an injury in order to stop bleeding and begin the process of healing. Here are the steps involved in blood clotting:

Vasoconstriction: When an injury occurs, the blood vessels in the affected area constrict, or narrow, to decrease blood flow and reduce bleeding.
Platelet activation: Platelets, which are small, disk-shaped cells found in the blood, become activated and begin to stick to the walls of the damaged blood vessels.
Platelet aggregation: Activated platelets release chemicals that attract more platelets to the site of the injury. These platelets then stick together, or aggregate, to form a plug that helps to stop the bleeding.
Formation of the fibrin mesh: The activated platelets release chemicals that stimulate the production of a protein called fibrin. Fibrin forms a mesh-like structure that helps to hold the platelet plug in place and strengthen the blood clot.
Blood clotting: The combination of the platelet plug and the fibrin mesh forms a blood clot that seals off the damaged blood vessel and stops the bleeding. Clot retraction: Once the blood clot has formed, the platelets in the clot contract, or shrink, to help pull the edges of the damaged blood vessel together and further seal the wound.
Clot dissolution: After the injury has healed, the body begins to dissolve the blood clot. This is done through the action of enzymes called plasminogen activators, which break down the fibrin in the clot.

The boatbill is present in a density of at least one pair per 20 acres at the same time that two different types of plants are dominant. What are these plants?
A. Weeds and grasses
B. Grasses and Shrubs
C.Shrubs and small trees
D. small trees and canopy trees

Answers

The two types that the boatbill will dominate are grasses and shrubs according to the attached table. So the correct option is B.

What is the boatbill?

The boatbill is a type of bird genus that will be predominantly in grasses and shrubs. They can change the composition of these areas as time passes. This type of bird will feed mainly on insects, cicadas being the main ones in its diet. They can also feed on small fish or small animals such as lizards. But its main diet is not other animals but it can also feed on fruits.

As for its reproduction, the female will be in charge of building the nest with sticks and herbs that the male will provide. Once the nest is formed, the female will lay her eggs in it and the incubation period will be given so that the chicks leave this and after a certain time, leave the nest.

Therefore, we can confirm that the correct option is B. grasses and shrubs.

To learn more about birds visit: https://brainly.com/question/25120645

#SPJ1

Pls help. I have no brain cells at this point-_-
This is a response of the immune system to a substance it incorrectly identifies as a
foreign pathogen.

A.humoral
B.immunity
C.antigen
D.allergies

Answers

the answer would be d
B. Vaccines are a great example of this because the immune system responds with immunity to that foreign pathogen that was given to the body

A DNA s
equence has mutated from

AAG G
CA TTC
-
t
o the sequence of

AAG GCT ATT C
-
. This mutation is an
example of a/an ___________________?
a.
Frameshift mutation
b.
Point
mutation
c.
Triple shift mutation
d.
Chromosomal
mutation

Answers

Answer:

Explanation:

The mutation is from AAG GCA TTC to AAG GCT ATTC

So there is a frameshift with an insertion of a T

Answer is a Frameshift mutation.

Answer:

Explanation:

its an example of single insertion leading to a frameshift mutation

The human genome project was able to map the human genome and it is now
completed. Why is this important in science?

Answers

Answer:

What is the Human Genome Project? The Human Genome Project was the international research effort to determine the DNA sequence of the entire human genome. In 2003, an accurate and complete human genome sequence was finished two years ahead of schedule and at a cost less than the original estimated budget.

Explanation:

The finished sequence produced by the Human Genome Project covers about 99 percent of the human genome's gene-containing regions, and it has been sequenced to an accuracy of 99.99 percent.

I need someone to explain this

Answers

it would be carbon dioxide and oxygen. the carbon dioxide is exhaled by the human and then the plant takes it in. the plant exhales the oxygen and the human inhales it. and it continues in a circle over and over.

interactions between the red blood cells and important molecules, cells, and organs in the heart​

Answers

Answer:

Gardos channel-mediated interactions with other cell types are indirect and often mediated by two other membrane proteins: PIEZO1 and an other unknown receptor. An example is the ability of RBC to change their ratio shape/volume to pass through narrow capillaries and interstices

A boy is riding a bike. If there were NO friction between the tires and the ground and NO air resistance, the boy would:()

Answers

Answer:

Friction is what makes the bike move forward. If there was no friction between the bike's wheels and pavement, the tires would just spin in place and the energy you put into pedaling would not translate into forward motion. ... Likewise, you could not stop without the friction of the brakes and the tires.

Explanation:

how many gender are really there? I believe that there are two male and female but people say that there are like 50

Answers

Ehhhhh i think 2 but IM NOT REPUBLICAN

I, and certain humans, not only think or believe but KNOW that there are only two. The end.

Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash

Answers

Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.

Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.

Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.

Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.

Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.

Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.

Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.

Learn more about Biomass at :

https://brainly.com/question/21525417

#SPJ4

Complete question:

1.plants

2.animals

3.animal waste

4.sunlight

5.paper

6.trash

4 elements that are never found in nature and only made by people

Answers

Answer: Halogen Family

The elements in this family are fluorine, chlorine, bromine, iodine, and astatine.

They are the most active non-metals. They are never found free in nature.

They react with alkali metals to form salts.

Explanation:

Which two statements describe force?​

Answers

Answer:

b........................

Ile Faller is of inheritance

Read each of the sentences that describe a physical change. Drag each sentence into the correct box.

Answers

Coat color in rabbits is expressed with four different phenotypes by a single gene. - This is an example of multiple alleles.

The trait of coat color is determine by one gene, but 4 different variants in that gene produce 4 different phenotypes.

When a certain variety of black chicken is crossed with a white chicken, all of the offspring are checkered. Black and white feathers  are produced in the offspring. This is an example of codominance - When black and white chickens are crossed, they produce heterozygous chickens that are checkered. This heterozygous phenotype results in the expression of both traits, as both are expressed in the phenotype. Then, when the heterozygotes are crossed, the homozygous black and white chickens and be produced again. If it was incomplete dominance, we would expect the rabbits to be grey.

The F1 generation produced by a cross between red-flowered (RR) and white-flowered (r) Four O clock plants consists of pink  colored flowers - this is an example of incomplete dominance, which is characterised by a blending phenotype, where one allele is not fully dominant over the other. If it was codominance, we would expect stripes or spots of both red and white.

The distribution of plant heights forms a bell-shaped curve with intermediate heights occurring most often. - this is an example of polygenic traits.  Height is usually not controlled just by one gene, instead it is the result of the action of several different genes that have small effects on the phenotype.

Leaves on a tree can have different sizes and shapes depending on the amount of light they receive. This is an example of environmental influence on gene expression - the light is an environmental factor that influences what and how genes are transcribed, producing effects on leaf shape.

Genetic disorders in human mitochondrial DNA follow non. Mendelian patterns of inheritance - this is an example of maternal inheritance. Mitochondrial DNA is only inherited from the mother, this is because during fertilization, the egg cell is so much larger than the sperm cell and contains so many more mitochondria. And this is the source of where all the mitochondria arise.

Your question is incomplete most probably your full question was

Read each of the sentences that describe a physical change. Drag each sentence i into the correct

Coat color in rabbits is expressed with four different phenotypes by a single gene.

When a certain variety of black chicken is crossed with a white chicken, all of the offspring are checkered. Black and white feathers

are produced in the offspring.

The F1 generation produced by a cross between red-flowered (RR) and white-flowered (r) Four o'clock plants consists of pink

colored flowers

8

33

3

1

L

I

=

TOT 3

TESTS

The distribution of plant heights forms a bell-shaped curve with internediate heights occurring most often.

Leaves on a tree can have different sizes and shapes depending on the amount of light they receive.

Genetic disorders in human mitochondrial DNA follow non. Mendelian patterns of inheritance,

a bell-shaped curve w

Genetic disorders in human mitoch

Incomplete dominance

Codominance

Multiple alleles

Polygenic traits Maternal inheritance

To look more about dominance click here

brainly.com/question/14053639

#SPJ4

What was the most significant conclusion that Mendel?

Answers

The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.

The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.

Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.

The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.

Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.

For more information on Mendel's experiment , visit :

https://brainly.com/question/30097040

#SPJ4

Complete question :

What was the most significant conclusion that Mendel drew from his experiments?

A There is considerable genetic variation in garden pea

B Traits are inherited in discrete units one from each parent

C Genes are composed of DNA

D Recessive genes occur as frequently as dominant ones.

B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas

Answers

Answer:

B) A. FALSO.  

B. VERDADERO.  

C. VERDADERO.

D. VERDADERO.

c) D. Contracción de los bronquios.

d) A. Axon, dendritas, cuerpo neuronal.

Explanation:

B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.

B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.  

C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.

D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.

c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:

D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.

d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:

A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Answers

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Which of the following is true of biogeochemical cycles?

Answers

Explanation:

The carbon, oxygen, and nitrogen cycles are all biogeochemical cycles. They show the movement of elements through living and nonliving components of the Earth. Carbon, oxygen, and nitrogen, are essential components of life that pass through organisms and nonliving components, but are never used up.

Antigen presenting cells in the human immune system work with T cells to kill invading pathogens (bacteria and viruses). Antigen presenting cells will identify the pathogen and present the antigen, which is a unique protein "name tag" of the pathogen, to the T Cell so that the T cell can find and kill the pathogen. This type of communication between the antigen presenting cell and the T cell is known as.

a. Direct contact b. Local signaling c. Long distance signaling d. Transduction signaling

Answers

This type of communication between the antigen presenting cell and the T cell is known as Transduction signaling, hence the correct option is d.

The act of a cell showing an antigen bound by major histocompatibility complex (MHC) proteins on its surface is known as antigen presentation, sometimes known as antigen presentation. Antigen presenting cell process antigens before they are presented to T cells. Antigens can be expressed in some form by almost all cell types. While cells that are infected with viruses (or cancer cells) can offer cytotoxic T cells with antigens that originate inside the cell, professional antigen-presenting cells, such as macrophages, B cells, and dendritic cells, provide helper T cells with exterior antigens. They may be found in several types of tissues. Through their T cell receptors, T cells may be able to recognise these complexes (TCRs).

To learn more about Antigen presenting cell click on the given link: https://brainly.com/question/13588471

#SPJ4

Part D: Consider Constraints
What limitations will there be to building an eco-friendly home in this neighborhood? Consider social, financial, and climate constraints while determining these limitations.

Answers

Social constraints such as zoning regulations and community resistance, financial constraints such as the cost of materials and labor, and climate constraints such as the availability of renewable energy resources and the local weather patterns.

What are limitations of eco-friendly home?

Eco-friendly homes may have limitations such as higher initial costs for construction or retrofitting, limited availability of certain materials and technologies, and a lack of standardization in building codes and regulations.

Additionally, some eco-friendly features, such as solar panels or green roofs, may not be suitable for all climates or may require regular maintenance. It's also worth noting that eco-friendly homes can be more energy-efficient but they may not be able to produce all the energy they need and they may still rely on grid energy.

Learn more about eco-friendly home, here:

https://brainly.com/question/8626176

#SPJ1

Which one of the following is not an environmental problem at the Chesapeake Bay?
a. Algal bloom
b. Man-made pollution
c. Increase in tidal wetlands and wild rice vegetation
d. Depletion of oysters that serve as natural water filters

Answers

Answer:

c

Explanation:

it's the only one that makes sense with the info you provided. it is the only answer that would seem to NOT cause environmental harm

Increase in tidal wetlands and wild rice vegetation is not an environmental problem at the Chesapeake Bay.

What is environmental problems?"It is the harmful effects of human activities on the environment."It includes: global warning, increasing pollution, overpopulation, climatic change, etc.

Chesapeake Bay is an estuary located in USA. The main problems associated with this is:

Increase nitrogen and fertilizers in water bodies can cause algal bloom.Accumulation of animal and human waste.Reduction in the number of oysters.Wetland destruction.Rise in water level.

Hence, the correct option is c. Increase in tidal wetlands and wild rice vegetation.

To learn more about environmental problems here

https://brainly.com/question/13254082

#SPJ2

what is the ratio of 15 minutes to 2 hours​

Answers

Answer:

15mins : 2 hrs

15 mins : 120 mins

1 : 8

Answer:

1:8

Explanation:

Convert 2 hours to minutes:

60*2 = 120 minutes

15/120 = 1:8

What is the probability that two parents with the genotype AaBb will produce an offspring with the genotype AaBb?

Answers

The probability of parents with the AaBb genotype producing offspring with the genotype AaBb is 4/16. Thus the correct answer is (b) 4/16.

The Punnett square method is used to forecast the prospective offspring from a certain cross based on the gametes of the parents. The parents carefully create the gametes that are arranged in a checkerboard pattern so they can understand all the potential children that can be generated. The likelihood of each prospective offspring can be determined using the checkerboard method. In the cross, there are four gametes produced by each of the two dihybrid parents. As a result, the hybrid has the capacity to produce a total of 16 offspring. Out of the 16 possible combinations, only four types of offspring can have the AaBb genotype.

Parents: AaBb*AaBb

Genotypes: AB   Ab    aB   ab *  AB    Ab   aB   ab

Offspring:   ABAB    ABAb   ABaB   ABab   AbAB   AbAb  AbaB  Abab  aBAB   aBAb   aBaB   aBab   abAB  abAb  abaB  abab

Percentage: AaBb: 4/16

The complete question is:

What is the probability of an AaBb offspring when you cross AaBb x AaBb parents?

a. 1/2

b. 4/16

c. 1/8

d. 1/32

e. 1/4

To learn more about cross between parent genotypes please click on the given link: https://brainly.com/question/26601444

#SPJ4

On irreversible effect of both deforestation and water pollution on the environment is the -
A- extinction of species.
B- thinning of the ozone shield.
C- depletion of the atmospheric carbon dioxide levels.

Answers

I think the answer is:
C
I’m not sure tho
Other Questions
Cell phones have given millions of people the ability to become photographers and videographers. Some of us are now able to document almost every aspect of our lives. Do you ever post images or videos online or share them with other people? Do you think the images we find online will serve as useful primary sources for historians in the future? Why or why not? Write down your views in two or three sentences what is 4-3x=-17 workout? Find the volume of this squarebased pyramid.10 in12 in[? ]in3 The Real Estate Products Division of McKenzie Co. is operated as a profit center. Sales for the division were budgeted for 2019 at $1,250,000. The only variable costs budgeted for the division were cost of goods sold ($610,000) and selling and administrative ($80,000). Fixed costs were budgeted at $130,000 for cost of goods sold, $120,000 for selling and administrative and $95,000 for noncontrollable fixed costs. Actual results for these items were: How do internet gateway routers help to defend the network from cyberattack? I need help with #4 and #5? PLEASE HELP IM FAILINGHow does the policy-setting role played by the Chinese communist party compare with the roles played by the parties in the US government? Compare and contrast the views of loyalists and patriots on American Independence from Great Britain(Three paragraphs please) Eli sells refrigerators. His base salary is $250 per week, and his commission is $50 for each refrigerator (r) that he sells. He needs to make more than $900 this week. Which TWO statements are correct for this situation?A) $50r + $250 < $900B) $50r $900C) $50r + $250 > $900 D) Eli needs to sell more than 13 refrigerators. E) Eli needs to sell more than 15 refrigerators. I need an example of each of these literacy devices for the book Night by Elie Wiesel.1. Analogy 2. Repetition3. Hyperbole4. Irony5.Anaphora6.Imagery7.Allusion8.Elaboration9.Personification10.Connotation11.Alliteration12.Conflict13. Tone14. Mood15.Idiom16.Metaphor17.Simile18.Onomatopoeia19. Shift20.Syntax Militarism is described asThe building up of weapons and military as a show of force.Promising to defend other countries in need.Extreme love of ones country.Building up an empire and expanding wealth What is the overall mood of the Second Coming? How does the role of the poet in the Victorian Age differ from the role of the poet in the Romantic Age? What are the advantages of reading a book instead of watching a film? Employee A gets paid $150 weekly, plus $0.50 for each latte they sell. If he was paid $275,how many lattes did he sell this week? The enthalpy of solution of KBr in water is about 198 kJ/mol. Nevertheless, he solubility of KBr in water is relatively high. Why does the solution process occur even though it is endothermic? Which of the following describes both the growth in information that inundates businesses each day and the complex tools used to analyze the data and derive meaningful insights ?A. Big DataB. Blog MiningC. Data VisualizationD. Machine Learning PLEASE HELP PICTURE ATTACHED Given the diagram below, which statement is true?A. /1 and /2 are vertical angles and supplementary.B. /2 and /3 are complementary angles and congruent.C. /1 and /3 are vertical angles and congruent.D. /2 and /4 are supplementary angles and congruent. Match the partition type to its description.1 . Logical partition A partition with an extended partition 2 . System partition The partition where you place the boot loader 3 . Primary partition The section of the hard drive that will become the bootable drive Find the sum of the interior angles of a nonagon. A. 140 B. 1,620 C. 1,260 D. 1,450