part 2. Algebraically find the inverse of the function

1. f(x) = -3(x - 4)^2 - 6

2. y = sqrt (x - 4)^2 + 3

3. y = 4 cube root (x)​

Answers

Answer 1

Answer:

1. f⁻¹(x) = ±²√(-⅓(x + 6)) + 4

2. y = ²√(x–3) + 4

3. y = (x/4)³

Answer 2

9514 1404 393

Answer:

f⁻¹(x) = 4 ±(1/3)√(-3x-18)y = (x -3)² +4y = x³/64

Step-by-step explanation:

To find the inverse function, solve for y the equation ...

  x = f(y)

__

1.

  [tex]x=f(y)\\\\x=-3(y-4)^2-6\\\\x+6=-3(y-4)^2\qquad\text{add 6}\\\\\pm\sqrt{\dfrac{x+6}{-3}}=y-4\qquad\text{divide by -3, square root}\\\\4\pm\dfrac{1}{3}\sqrt{-3(x+6)}=y\qquad\text{add 4, rationalize the denominator}\\\\\boxed{f^{-1}(x)=4\pm\dfrac{1}{3}\sqrt{-3x-18}}\qquad\text{simplify the radical}[/tex]

__

2.

  [tex]x=\sqrt{y-4}+3\\\\x-3=\sqrt{y-4}\qquad\text{subtract 3}\\\\(x-3)^2=y-4\qquad\text{square both sides}\\\\\boxed{y=(x-3)^2+4}\qquad\text{add 4}[/tex]

__

3.

  [tex]\displaystyle x=4\sqrt[3]{y}\\\\\frac{x}{4}=\sqrt[3]{y}\\\\\left(\dfrac{x}{4}\right)^3=y\qquad\text{cube both sides}\\\\\boxed{y=\dfrac{x^3}{64}}[/tex]


Related Questions

what value of x makes the following equation true?​

Answers

Answer:

12

Step-by-step explanation:

Solve for  x  by simplifying both sides of the equation, then isolating the variable.

Hope this helps! :D

please help!!!! will mark brainlist! am I right??​

Answers

Answer:

you are corcect

Step-by-step explanation:

12a

A boy is standing on the very edge of a cliff that is 58.8 m high. The boy throws a rock straight up in the air at 7.36 m/s. (a) What is the rock's velocity when it hits the ground? (use up as the positive direction)
How long (from the time it was thrown) will it take for the rock to hit the ground?
What is the total distance traveled by the rock?

Answers

Answer:

The exact same from when it went up

Step-by-step explanation:

it never said the rock was thrown at a angle besides directly up and the boy didn't move so it hit his head

The following are data on number of policemen and number of crimes. Find out if there is a correlation between these two variables. NumPolice NumCrimes 15 17 17 19 25 16 27 20 17 12 12 15 12 11 22 27 Using the test of correlation, What is the correct interpretation of the correlation coefficient in this example?
a. The interpretation would be there is a moderate positive correlation between number of policemen on duty and number of crimes
b. The interpretation would be there is a strong negative correlation between number of policemen on duty and number of crimes
c. The interpretation would be that TNOETS that there is a correlation between number of policemen on duty and number of crimes.
d. The interpretation would be that there is a strong positive correlation between number of policemen on duty and number of crimes

Answers

Definitely D according abc make no sense

Solve for x

(8x-29)+(3x-1)+(6x-11)=180

Answers

Answer:

x= 13

Step-by-step explanation:

can i please get branlist? if not thats okay.

X equals 13!!!! :))


Simplifying
8x + -29 + 6x + -11 + 3x + -1 = 180

Reorder the terms:
-29 + -11 + -1 + 8x + 6x + 3x = 180

Combine like terms: -29 + -11 = -40
-40 + -1 + 8x + 6x + 3x = 180

Combine like terms: -40 + -1 = -41
-41 + 8x + 6x + 3x = 180

Combine like terms: 8x + 6x = 14x
-41 + 14x + 3x = 180

Combine like terms: 14x + 3x = 17x
-41 + 17x = 180

Solving
-41 + 17x = 180

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '41' to each side of the equation.
-41 + 41 + 17x = 180 + 41

Combine like terms: -41 + 41 = 0
0 + 17x = 180 + 41
17x = 180 + 41

Combine like terms: 180 + 41 = 221
17x = 221

Divide each side by '17'.
x = 13

Simplifying
x = 13

Please help!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

45∘

Step-by-step explanation:

So, the reference angle is 360∘−315∘=45∘

Hope this helps! :D

:D im
Pretty sure lol

Given f(x)=3x-4 and g(x)=-2x+7 evaluate

Answers

Step-by-step explanation:

e...

First;

g(5)=-2×5+7=-3

then

f(g(5))=3×-3-4=-9-4=-13

f...

g(2)=-2×2+7=3

now

g(g(2))=-2×3+7=1

PLEASEEEEEEE HELLPPPPP​

Answers

Answer:

a) 3.5metres

b) 34metres

Find the product of the sum of 52 and 18 and the difference of 86 and 41.

Answers

Answer:

2450

Step-by-step explanation:

52+18=70

86-41=45

70×45=2450

The product of the sum of 52 and 18 and the difference of 86 and 41 is 3150.

What is expression?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is the sum of 52 and 18 and the difference of 86 and 41.

We can write the expression as -

{x} = (52 + 18) x (86 - 41)

{x} = 70 x 45

{x} = 3150

Therefore, the product of the sum of 52 and 18 and the difference of 86 and 41 is 3150.

To solve more questions on expressions, visit the link below -

brainly.com/question/1041084

#SPJ2

need help asap on 9, 10,and 11

Answers

Step-by-step explanation:

9. a)

2•(-2) = 2 - 6

-4 = -4

-2 -2 = -2•2

-4 = -4

Yes, the ordered pair is the solution

9. b)

-1 = 3•(-2) +5

-1 = -6 +5

-1 = -1

3•(-2) +(-1) = -2

-6 -1 = -2

-7 ≠ -2

No, the ordered pair is not the solution

10. (-1, -1) and (3, -1)

11.

y = 6 +x

Now substitute it in the first equation:

3•(6 +x) = 5x

18 + 3x = 5x

18 = 2x

x = 18/2

x = 9

Now, substitute x = 9 in the second equation:

y -9 = 6

y = 6 +9

y = 15

x : y : z = 2 : 3 : 5 và x-y+3z= -28

Answers

Answer:

2 - 3 + 15 = 14

Step-by-step explanation:

Two trains leave towns 840 miles apart at the same time and travel toward each other. One train travels 20 mi/h slower than the other. If they meet in 5 hours what is the rate of each train?

Answers

CHIPOTLE, CHICK-FIL-A, BURGER KING, MCDONALDS… ETC. fathdhbudRhfyjufik__ 840

5,339x6= What is the estimate

Answers

the answer is 32,000

[tex]5,339 \: \times \: 6=32034 \\ = 32000[/tex]

- BRAINLIEST answerer ❤️

Ali bought 2kg of potato and 3kg of onion. The price of the onion is 50 cents less
than potato. He paid $10 to the cashier and get back $1.50. What is the price for 1kg
of onion ?

Answers

Answer:

1kg of onion is $1.5

Step-by-step explanation:

He paid $10 and got $1.50 back, meaning that the total price for the 2kg and 3kg of the potato and onion is:

10 - 1.5 = $8.50

Now, equating the prices of the two (take x as the cost of the potato per kg and take y as the cost of the onion per kg):

x -0.5 = y

x - y = 0.5  ---- Eq 1

Equating the total costs:

2x + 3y = 8.5 ---- Eq 2

Multiplying Eq 1 by 2:

2x - 2y = 1 ---- Eq 1'

Subtracting Eq 2 from Eq 1':

2x - 2x +3y - (-2y) = 8.5 - 1

5y = 7.5

y = 1.5

Substituting this into the first equation:

x - 1.5 = 0.5

x = 2

Hence,

the cost of the Potato is $2, and

the cost of the Onion per kg is $1.5

Hope this helps, and have a wonderful time ahead on Brainly!

John bought a quart of ice-cream for $4.80. How much does the ice-cream cost per cup? 1 guart = 4 cups

Answers

Answer:

each cup is $1.20 each

Step-by-step explanation:

hope this helps

round 0.25 to the nearest hundredth ​

Answers

Answer:

0.25

Step-by-step explanation:

there is no hundredth in 0.25

Rounding 0.25 to the nearest hundredth gives us 0.26.

We must look at the digit in the thousandth place, which is the following decimal place after the hundredth place, in order to round 0.25 to the closest hundredth.

We round up the digit in the hundredth place by adding 1 since the digit in the thousandth place is 5, which is equal to or larger than 5.

Thus, 0.26 is obtained by rounding 0.25 to the next tenth.

0.25 (initial number) worked

(Number in the thousandth place) (Number in the hundredth position)

We round up the digit in the hundredth place since the digit in the thousandth place is 5, which is 5.

Hence rounding to the nearest hundredth, 0.25 equals 0.26.

Learn more about rounding figures click;

https://brainly.com/question/29261078

#SPJ6

2b with a exponent of 3 +5

Answers

Answer:

2b[tex]^{8}[/tex]

K to the power of negative 2 multiplied by 2

Answers

Answer:

2k-²

Step-by-step explanation:

i hope this is the answer ur looking for !

How much would you need to deposit in an account now in order to have $3000 in the account in 10 years? Assume the account earns 4% simple interest. Round your answer to the nearest cent.

Answers

ANSWER:

50,000

hope it helps you


Solve.
2(y + 7) = 28
Answer:

Answers

Answer:

y=7

Step-by-step explanation:

Find the sine ratio of angle O. Hint: Use the slash symbol (/) to represent the fraction bar, and enter the fraction with no spaces. (4 points)

Answers

Hello,

Correct Answer is 12/3

Step-by-step explanation:-

For angle theta, perpendicular side is AB=12 and hypotenuse side is BC=13.

The sine of angle is equal to the ratio of perpendicular side to the hypotenuse side. So, sine of angle theta is:-

[tex]sin \: θ = \frac{12}{3} [/tex]

So, sine ratio angle is 12/3.

{ Note: Here, the ratio is written using slash (/) symbol as it is asked to use the slash symbol in the answer. }

✍️ By Benjemin ☺️

Enter the correct answer in the box
Simplify the expression (62)4

Answers

Answer:

62•4=248

[tex]63^{4} =2^{24}[/tex]

Step-by-step explanation:

I didn't know which one you needed so here's both.

Explain the steps you would take to find a quotation of 1/3÷4/3

Answers

Answer:

Answer btw is 1/4 ;)

Step-by-step explanation:

First step in dividing fractions is to flip the second fraction, aka find the inverse.

[tex]\frac{1}{3}/\frac{4}{3} \\\frac{1}{3}*\frac{3}{4}[/tex]

All you have to do from here is multiply.

[tex]\frac{3}{12}=\frac{1}{4}[/tex]

Boom.

what is the product of -6 and -54

Answers

Answer:

324

Step-by-step explanation:

- 6 × - 54 = 324

Note : -

When a negative number multiplied with another negative number, its result is a positive number.

Hello your answer is gonna be 324












M

What is the distance between the points (−7, −3) and (−7, −9) ?

A 12 units

B 10 units

C 6 units

D 4 units

Answers

Answer:

C. 6 units

Step-by-step explanation:

Since the points have same x- coordinate of -7, the distance is the difference in y - coordinates:

d = -3 - (-9) = -3 + 9 = 6

Correct choice is C

(-7,-3)(-7,-9)

Distance

[tex]\\ \sf\longmapsto \sqrt{(-7+7)^2+(-9+3)^2}[/tex]

[tex]\\ \sf\longmapsto \sqrt{(-6)^2}[/tex]

[tex]\\ \sf\longmapsto \sqrt{36}[/tex]

[tex]\\ \sf\longmapsto 6[/tex]

Which data set has the same standard deviation as the data set {2, 2, 5, 6, 8} ?
{3, 4, 4, 7, 7}


{5, 6, 5, 6, 5}


{3, 3, 6, 7, 9}


{4, 4, 5, 5, 5}

Answers

Answer:

{3, 3, 6, 7, 9}

You’re recording inventory after a big weekend sale in the travel section of a department store. There are 20 remaining suitcases, of which 16 will be further marked down. True or False: The fraction 2016
20
16
is in the simplest form.

Answers

Answer:

false

Step-by-step explanation:

Given that the remaining suitcases is 20

And 16 of the remainig suitcases will be further marked down, then the simplest form will be;

16/20.

For a quadrilateral ABCD inscribed in a circle of radius 1, let AB : AD = 1 : 2 and ∠BAD = 120°. Also, when the point of intersection of diagonals BD and AC is denoted by E, let BE : ED = 3 : 4. Please find the area of triangle ABD and triangle BCD. (Show work)

Answers

The area of triangle ABD = x² * √3 / 2 and The area of triangle BCD =       y * √(5x² + 4y² - 2xy√5)

To find the area of triangle ABD, we can use the formula for the area of a triangle: Area = (1/2) * base * height

In triangle ABD, the base is AD and the height is the perpendicular distance from point B to line AD. Since AB : AD = 1 : 2, we can let AB = x and AD = 2x.

Now, we can use the Law of Cosines to find the length of side BD. In triangle ABD, we have:

BD² = AB² + AD² - 2 * AB * AD * cos(∠BAD)

BD² = x² + (2x)² - 2 * x * (2x) * cos(120°)

Simplifying the equation:

BD² = x² + 4x² - 4x² * (-1/2)

BD² = 5x²

Taking the square root of both sides:

BD = √(5x²) = x√5

Since BE : ED = 3 : 4, we can let BE = 3y and ED = 4y.

Now, we can find the length of side BC. In triangle BCD, we have:

BC² = BD² + CD² - 2 * BD * CD * cos(∠BCD)

BC² = (x√5)² + (2y)² - 2 * (x√5) * (2y) * cos(∠BCD)

BC² = 5x² + 4y² - 4xy√5 * cos(∠BCD)

Since the quadrilateral ABCD is inscribed in a circle, ∠BCD = 180° - ∠BAD = 60°.

BC² = 5x² + 4y² - 4xy√5 * cos(60°)

BC² = 5x² + 4y² - 4xy√5 * (1/2)

BC² = 5x² + 4y² - 2xy√5

The area of triangle ABD is given by:

Area ABD = (1/2) * AB * AD * sin(∠BAD)

Area ABD = (1/2) * x * 2x * sin(120°)

Area ABD = x² * √3 / 2

The area of triangle BCD is given by:

Area BCD = (1/2) * BC * CD * sin(∠BCD)

Area BCD = (1/2) * √(5x² + 4y² - 2xy√5) * 2y * sin(60°)

Area BCD = y * √(5x² + 4y² - 2xy√5)

Further calculations require numerical values for x and y to obtain specific areas.

For more such questions on area of triangle

https://brainly.com/question/28470545

#SPJ8

A sports marketing company interviewed 250 Supersport United fans and has found that the average fan spends R101 on non-ticket purchases at the stadium when he/she attends a home match. This includes money spent on food, drinks and merchandise. Assume that the standard deviation is R39.

Find the lower and upper limits for the average amount spent on non-ticket purchases per match by Supersport United fans. Use a confidence level of 90%. Round off your answers to 2 decimal places (4)​

Answers

The 90% confidence interval is between R96.94 and R105.06

The confidence (C) = 90% = 0.9, Mean (μ) = 101, standard deviation (σ) = 39, sample size (n) = 250

α = 1 - C = 1 - 0.9 = 0.1

α/2 = 0.1 / 2 = 0.05

The z score of α/2 corresponds with the z score of 0.45 (0.5 - 0.05) which is equal to 1.645

The margin of error (E) is given by:

[tex]E=Z_\frac{\alpha }{2} *\frac{\sigma}{\sqrt{n} } \\\\E=1.645 *\frac{39}{\sqrt{250} } =4.06[/tex]

The confidence interval = μ ± E = 101 ± 4.06 = (96.94, 105.06)

Therefore the 90% confidence interval is between R96.94 and R105.06

Find out more at: https://brainly.com/question/18914334

What is the missing reason for the 5th step in the proof below?
A: Substitution
B: Simplification of equation from previous step
C: Definition of linear pair
D: Definition of complementary angles

Answers

Answer: B

Step-by-step explanation:

Other Questions
PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 Steam Workshop Downloader