Requirement 1. Compute cost of goods sold and gross profit using the FIFO inventory costing method.
Begin by computing the cost of goods sold and cost of ending merchandise inventory using the FIFO inventory costing method. Enter the transactions in chronological​ order, calculating new inventory on hand balances after each transaction. Once all of the transactions have been entered into the perpetual​ record, calculate the quantity and total cost of merchandise inventory​purchased, sold, and on hand at the end of the period.​ (Enter the oldest inventory layers​ first.)
Purchases
Cost of Goods Sold
Inventory on Hand
Unit
Total
Unit
Total
Unit
Total
Date
Quantity
Cost
Cost
Quantity
Cost
Cost
Quantity
Cost
Cost
May 1
11
23
26
29
Totals
Compute gross profit using the FIFO inventory costing method.
Gross profit is $
using the FIFO inventory costing method.
Requirement 2. Compute cost of goods sold and gross profit using the LIFO inventory costing method.
Begin by computing the cost of goods sold and cost of ending merchandise inventory using the LIFO inventory costing method. Enter the transactions in chronological​ order, calculating new inventory on hand balances after each transaction. Once all of the transactions have been entered into the perpetual​ record, calculate the quantity and total cost of merchandise inventory​purchased, sold, and on hand at the end of the period. ​(Enter the oldest inventory layers​ first.)
Purchases
Cost of Goods Sold
Inventory on Hand
Unit
Total
Unit
Total
Unit
Total
Date
Quantity
Cost
Cost
Quantity
Cost
Cost
Quantity
Cost
Cost
May 1
11
23
26
29
Totals
Compute gross profit using the LIFO inventory costing method.
Gross profit is $
using the LIFO inventory costing method.

Answers

Answer 1

Answer:

The question is incomplete because the numbers are missing, so I looked for a similar question that can help you understand how this works.

June 1 Beginning inventory 17 units at $15 each June  12  Purchase 5 units at $19 each June 20 Sale 14 units at $37 each  = $518June 24 Purchase 11 units at $23 each June 29 Sale 13 units at $37 each = $481

Cost of goods sold under FIFO (first in, first out):

June 20 sale = 14 units x $15 = $210

Inventory on hand:

June 1 Beginning inventory 3 units at $15 each June  12  Purchase 5 units at $19 each

June 29 sale = (3 units x $15) + (5 units x $19) + (5 units x $23) = $255

Inventory on hand:

June 24 Purchase 6 units at $23 each

Total COGS = $465

Ending inventory = $138

Gross profit = ($518 + $481) - $465 = $534

Cost of goods sold under LIFO (last in, first out):

June 20 sale = (5 units x $19) + (9 units x $15) = $230

Inventory on hand:

June 1 Beginning inventory 8 units at $15 each

June 29 sale = (11 units x $23) + (2 units x $15) = $283

Inventory on hand:

June 1 Beginning inventory 6 units at $15 each

Total COGS = $513

Ending inventory = $90

Gross profit = ($518 + $481) - $513 = $486


Related Questions

Lonergan Company occasionally uses its accounts receivable to obtain immediate cash. At the end of June 2021, the company had accounts receivable of $1,060,000. Lonergan needs approximately $640,000 to capitalize on a unique investment opportunity. On July 1, 2021, a local bank offers Lonergan the following two alternatives:

a. Borrow $640,000, sign a note payable, and assign the entire receivable balance as collateral. At the end of each month, a remittance will be made to the bank that equals the amount of receivables collected plus 9% interest on the unpaid balance of the note at the beginning of the period.
b. Transfer $690,000 of specific receivables to the bank without recourse. The bank will charge a 2% factoring fee on the amount of receivables transferred. The bank will collect the receivables directly from customers. The sale criteria are met.

Required:
1. Prepare the journal entries that would be recorded on July 1 for:

a. alternative a.
b. alternative b.

2. Assuming that 80% of all June 30 receivables are collected during July, prepare the necessary journal entries to record the collection and the remittance to the bank for:

a. alternative a.
b. alternative b.

Answers

Answer and Explanation:

The Journal entry is shown below:-

1. a. Cash  Dr, $640,000

   To Notes Payable   $640,000

(Being notes payable is recorded)

b. Cash   Dr, $676,200

Loss on transfer of receivable Dr, $13,800  ($390,000 × 2%)

       To Account receivable  $690,000

(Being accounts receivable is recorded)

2. a. Cash  Dr, 848,000

      To Account Receivable  $848,000 ($1060,000 × 80%)

(Being account receivable is recorded)

b. Cash  Dr, $158,000  ($1060,000 × 80%) - $690,000

To Account Receivable   $158,000

(Being account receivable is recorded)

Exercise 1-13 Identifying effects of transactions using the accounting equation LO P1 Ming Chen began a professional practice on June 1 and plans to prepare financial statements at the end of each month. During June, Ming Chen (the owner) completed these transactions. a. Owner Invested $59,000 cash in the company along with equipment that had a $16,000 market value in exchange for its common stock. b. The company paid $2,500 cash for rent of office space for the month. C. The company purchased $17,000 of additional equipment on credit (payment due within 30 days). d. The company completed work for a client and Immediately collected the $2,500 cash earned. e. The company completed work for a client and sent a bill for $7,300 to be received within 30 days. f. The company purchased additional equipment for $5,900 cash. g. The company paid an assistant $3,500 cash as wages for the month. h. The company collected $4,600 cash as a partial payment for the amount owed by the client in transaction e. 1. The company paid $17,000 cash to settle the liability created in transaction c. J. The company paid $1,100 cash in dividends to the owner (sole shareholder).

Answers

Answer:

I used an excel spreadsheet since there is not enough room here.      

Explanation:

Effects of transactions using the accounting equation in this transaction will be in the form of double entry.

What is an accounting equation?

Accounting is the practice of consistently keeping track of and handling account balances. Basic accounting keeps track of transactions and makes them transparent. All company transactions are split into credits and debits using this system.

Receivables are any possessions that have the potential to provide future financial gain. Your debts to other people are called liabilities.

The accounting equation will be:

Asset = liabilities + equity

The equation in the lengthy form will be:

Assets = Liabilities + Owner's Capital - Owner's Drawings + Revenues - Expenses.

Ming Chen began a professional practice on June 1 and plans to prepare financial statements at the end of each month. so he needs to record every transaction and account for them in the balance sheet, assets, liabilities, and owner's equity.

Learn more about accounting equation, here:

https://brainly.com/question/28288376

#SPJ2

HELP ASAP!!! ! Suppose the government raises taxes on the profits of oil companies. we should expect which of the following? A less innovation in the production of oil and therefore higher oil prices. B The price of oil to be unchanged. C Oil companies will increase production in an attempt to increase revenue. D None of the above will happen.

Answers

Answer:

sdedcfgrtgf

Explanation:

gtgtgtgtgtgtgtgtgtgtgt

B Corp. has an employee benefit plan for compensated absences that gives each employee 10 paid vacation days and 10 paid sick days. Both vacation and sick days can be carried over indefinitely. Employees can elect to receive payment in lieu of vacation days; however, no payment is given for sick days not taken. At December 31, 2021, B's unadjusted balance of liability for compensated absences was $34,000. B estimated that there were 320 total vacation days and 160 sick days available at December 31, 2021. B's employees earn an average of $192 per day. In its December 31, 2021, balance sheet, what amount of liability for compensated absences is B required to report

Answers

Answer: $61,440

Explanation:

Employees can receive payments only for Vacation days and not sick days.

The total number of Vacation days is 320.

Employees make an average of $192 per day so the liability for compensated absences will be;

= 192 * 320

= $61,440

Josiah has operated a small mechanic shop for about two years. He has noticed that one employee is much better at welding than the others, another is better at diagnosing the problems with vehicles, and another is better at taking vehicles apart, removing the damaged parts, and then reinstalling the repaired or new parts. Because the business is growing and needs to be run more efficiently than it has in the past, Josiah is considering revamping job assignments. In the past he has let the employees chose what they want to do each day. Considering the abilities of his employees, what would be the best way for him to streamline his business

Answers

Answer:

(b) utilize job specialization

Explanation:

These are the options for the question;

(a) make the employee who can diagnose problems the manager

(b) utilize job specialization

(c) utilize job rotation

From the question, we are informed about how Josiah has operated a small mechanic shop for about two years.and how he was able to discover different area of specialization for his employees, in different areas such as welding, removal of the damaged parts, reinstallation of the repaired of new parts.

In this case of Considering the abilities of his employees, the best way for him to streamline his business is utilize job specialization.

Job specialization brings effectiveness as well as efficiency, it is the process in which the employees are able to concentrate on a specific area of the job and allow then to carry the specific role effectively. Job specialization helps in division of task among employee and it increase production as well time management.

Third Parties In General (not Just With Health Care) Are Inefficient Because
a) its not their money
b) it means a large bureaucracy
c) it aways involves insurance
d) all above

Answers

Answer:

Third Parties In General (not Just With Health Care) Are Inefficient Because

b) it means a large bureaucracy.

Explanation:

Ordinarily, in an efficient market, there are no third parties.  The market participants remain buyers and sellers.  They are aided in their business dealings and for the determination of prices during the exchange by the invisible hand.  It is the invisible hand that ensures the existence of market equilibrium between demand and supply.  If this invisible hand is removed and a third party comes in to regulate the market and the activities of the market participants, usually the government, it implies that bureaucracy will increase.  It has been established that decisions made by the state are not always efficient because more costs are added to the decision-making process.

Foote Company recorded a purchase discount of $200 on merchandise the company had purchased on account a few days ago. Foote uses the perpetual inventory system. Which of the following answers reflects the effects of this event on the financial statements? Balance Sheet Income Statement Statement of Cash Flows Assets = Liabilities + Stockholders’ Equity Revenue − Expense = Net Income A. n/a (200) 200 200 n/a n/a 200 OA B. n/a (200) 200 200 n/a 200 n/a C. (200) (200) n/a n/a n/a n/a (200) OA D. (200) (200) n/a n/a n/a n/a n/a

Answers

Answer:

B. n/a (200) 200 200 n/a 200 n/a

Explanation:

A purchase discount is a contra-expense account which has a credit balance. Expenses have normal debit balances, so a credit balance will decrease the expenses incurred by the company.

E.g. you paid $100 within the discount period (2% discount)

Dr Accounts payable 100

    Cr Cash 98

    Cr Purchase discounts 2

This transaction doe snot affect assets, but it will decrease liabilities by $200 and increase R.E. by $200. Since this is a contra expense account, it will increase revenue and net income. It doesn't generate any additional cash flows.

The CEO would like to see higher sales and a forecasted net income of $1,000,000. Assume that operating costs (excluding depreciation and amortization) are 55% of sales and that depreciation and amortization increase by 6% and interest expenses will increase by 5%. The tax rate, which is 40%, will remain the same. (Note that while the tax rate remains constant, the taxes paid will change.) What level of sales would generate $1,000,000 in net income? If necessary, round your answer to the nearest dollar at the end of the calculations.

Answers

Answer:

The numbers are missing, so I looked for a similar question, but the ones I found had different numbers. I hope it can help you understand how to solve this one:

Hermann Industries is forecasting the following income statement:

sales $8,000,000 operating costs excluding depr & amort. 4,400,000 EBITDA $3,600,000 depreciation & amortization 800,000 EBIT 2,800,000 Interest 600,000 EBT 2,200,000 Taxes (40%) 880,000 Net income 1,320,000

The CEO would like to see higher sales and a forecasted net income of 2,500,000. Assume that operating costs (excluding depreciation and amortization) are 55% of sales and that depreciation and amortization and interest expenses will increase by 10%. the tax rate, which is 40%, will remain the same. what level of sales would generate 2,500,000 in net income?

We have to first calculate net income before taxes:

net income = net income before taxes x 60%

net income before taxes = $2,500,000 / 0.6 = $4,166,667

now, net income before taxes = EBIT - interests

$4,166,667 = EBIT - ($600,000 x 110%)

EBIT = $4,166,667 + $660,000 = $4,826,667

now it's EBITDA turn:

EBITDA = EBIT + depreciation and amortization

EBITDA = $4,826,667 + ($800,000 x 110%) = $5,706,667

finally:

total sales = EBITDA + operating costs excluding depr & amort., we can replace total sales by X

X = EBITDA + 0.55X

0.45X = $5,706,667

X = $5,706,667 / 0.45 = $12,681,482.22 ≈ $12,681,482

sales level that will result in a $2,500,000 net income = $12,681,482

The cost C and the revenue R for a brokerage firm depend on the number T of transactions executed. (Both C and R are measured in dollars.) It costs $730 per day to keep the office open, and brokers are paid an average of $25 per transaction. Also, $35 in fees are collected for each transaction. (a) Find a formula that gives C as a function of T. C(T) = (b) Find a formula that gives R as a function of T. R(T) = (c) Find the number of daily transactions that are needed to make the revenue $1200 more than the cost. 33 daily transactions

Answers

Answer:

C(T) = $730 + $25T

R(T) = $35T

T = 193 transactions

Explanation:

Given that:

C = cost ; R = revenue ; T = number of transactions

Amount paid per transaction = $25

Cost keeping office open = $730

Amount collected on each transaction = $35

(a) Find a formula that gives C as a function of T.

C(T) = Cost of keeping office open + (cost per transaction × number of transactions)

C(T) = $730 + $25T

(b) Find a formula that gives R as a function of T.

R(T) = (Amount collected per transaction * number of transactions)

R(T) = $35T

(c) Find the number of daily transactions that are needed to make the revenue $1200 more than the cost.

R = C + 1200

Substitute the value of R and C into the equation:

35T = 730 + 25T + 1200

35T - 25T = 730 + 1200

10T = 1930

T = 1930 / 10

T = 193 transactions

7. What is not an example of a spending mistake?
A Paying only the minimum payments on your credit card each month.
B Spending more than you make.

C Paying all of your bills on time. W
D Paying your cable bill late.

Answers

C even though it a liability still but a roof over your head

Ahmed knows the bakery must make at least 6 and at most 48 batches of the Chocolate Decadence. The bakery must also make between 3 and 42 batches of the Mint Breezes. The batches of Chocolate Decadence take 7 minutes in the oven, while batches of Mint Breezes require 8 minutes in the oven. The bakery only has 392 minutes in the oven available. If batches of Chocolate Decadence generate $2.56 in income, and batches of Mint Breezes generate $1.29, how many batches of the pies should Ahmed have the bakery make to get the most income

Answers

Answer:

Ahmed must bake 48 Chocolate Decadence pies and 7 Mint Breezes pies in order to get the maximum possible profit = $131.91

Explanation:

let x = chocolate decadence

let y = mint breezes

maximize revenue equation = 2.56x + 1.29y

the constraints are:

7x + 8y ≤ 392

x ≥ 6

x ≤ 48

y ≥ 3

y ≤ 42      

using solver, profits are maximized when 48x + 7y = $131.91

Suppose a firm’s managers receive bonuses that increase with the size of the firm’s ROE, which was 30% last year and is forecasted to remain at this level during the coming year provided the firm takes on no new expansion projects. Its cost of capital is 10%. Now the firm has the opportunity to make a new investment that promises 20% return on invest capital. Which of the following statements is not correct?a. The example in this question demonstrates the serious weakness in using ROE as the primary criterion in setting executive compensation.b. The new project should be rejected because, if it is accepted, the firm's ROE will decline from 30% because the new ROE will be a weighted average of the old 30% and the 20% returns on the new investment.c. The new project should be accepted because it expected return exceeds the cost of the capital that will be used to finance it.

Answers

Answer:

.b. The new project should be rejected because, if it is accepted, the firm's ROE will decline from 30% because the new ROE will be a weighted average of the old 30% and the 20% returns on the new investment

Explanation:

ROE means return on equity

ROE = Net income / shareholders equity

A project should be undertaken if the ROE of the project is greater than the cost of equity

In an example, a local church is made up of people who are very different in their lifestyles and their stages of life. Mary is a 23-year-old single parent who earns the minimum wage. Jonathan is 60 years old, extremely wealthy, and works because he enjoys it. Jane is a 45-year-old lawyer who earns well and is well-respected in her profession. She is extremely career-oriented and is proud of her achievements. Which of the following do you think would motivate Jonathan the most?
a. safety
b. physiological
c. self-actualization
d. growth
e. esteem

Answers

Answer:

Option C (self-actualization) is the perfect approach.

Explanation:

The desire to achieve one's absolute capability is alluded to by self-actualization. It reflects a need for more improvement that people are continually looking for when they meet their maximum degree requirements. Although self-actualization is frequently depicted as life's result, Maslow proposed that it had been incredibly rare to genuinely reach complete self-actualization.

The latter preferences provided are not related to something like the situation described. So, the solution here is just the appropriate one.

CostPercent Complete Materials costs$ 5,80050% Conversion costs$ 6,50030% A total of 7,700 units were started and 6,600 units were transferred to the second processing department during the month. The following costs were incurred in the first processing department during the month: Materials costs$ 85,300 Conversion costs$ 168,000 The ending inventory was 70% complete with respect to materials and 10% complete with respect to conversion costs. The cost per equivalent unit for materials for the month in the first processing department is closest to:

Answers

Answer:

$11.49

Explanation:

The computation of cost per equivalent unit for materials for the month in the first processing department is shown below:-

Equivalent units for materials

= Units completed and transferred out + Units in ending inventory

 (6,600 × 100%) + ((800 + 7,700 - 6,600) × 70%)

= 6,600 + $1,330

= 7,930 units

Cost per equivalent unit for materials

= (5,800 + $85,300) ÷ 7,930

= $11.49

Jason sell appliances at Best Buy. He earns 12% on his total sales for the
week. Last week he made $690.48, what were his total sales for the week?
$3246.38
$1380.96
$5754
$7234.98

Answers

Answer:

$5754

Explanation:

Jason earns a 12% commission on total sales.

If he earned $690.48 last week, it means that 690.48 was equivalent to 12% of total sales.

i.e., 690.48 = 12% of total sales

Total sales = 100%

If 12% = 690.48

100% =690.48/12 x 100

=57.54 x 100

=$ 5,754

When Padgett Properties LLC was formed, Nova contributed land (value of $358,500 and basis of $89,625) and $179,250 cash, and Oscar contributed cash of $537,750. Both partners received a 50% interest in partnership profits and capital. a. How is the land recorded for § 704(b) book capital account purposes? For § 704(b) book capital account purposes, Padgett records the land at $ 358,500 . b. What is Padgett's tax basis in the land? $ 89,625 c. If Padgett sells the land several years later for $537,750, how much tax gain will Nova and Oscar report? Nova reports a $ gain and Oscar's gain is $ 89,625 .

Answers

Answer:Amount of Nova and Oscar's gain=$492,937.50

Explanation:

a)According to  Land recorded for   § 704(b) book capital account purposes, Land is  recorded at fair market value. With this, the Padgett properties should record the land at $358,500

b)From the question, it is given that the  basis of land is  $89,625. Therefore, the Padgett Properties LLC's tax basis in the land is $89,625.

c)Amount of Nova and Oscar's gain.

Fair market value of Land         $358,500

Basis of land                                  $89,625  

total                                              $ 448,125

but Gain =  Selling price of land - Fair value of Land  x interest in partnership profits and capital  

= $537,750 - ($358,500+$89,625 )

=($537,750 - $448,125 )  x 50% =$44,812.50

Total gain                   $448,125 + $44,812.50 =$492,937.50

Which of the following are reasons that the short-run aggregate supply curve slopes upward?

Answers

Answer:

The short-run aggregate supply curve slopes upward because of all of the following reasons except a. in the short run, as prices of final goods and services increase, some firms are very slow to adjust their prices, thus their sales increase. b. in the short run, an unexpected change in the price of an important resource can change the cost to firms.

Hope this helps :)

The following disclosures (excerpted) are from the September 2, 2018, annual report of Costco Wholesale Corporation.

The Company generally recognizes sales, net of returns, at the time the member takes possession of merchandise or receives services. When the Company collects payments from members prior to the transfer of ownership of merchandise or the performance of services, the amounts received are generally recorded as deferred sales, included in other current liabilities in the consolidated balance sheets, until the sale or service is completed. The Company reserves for estimated sales returns based on historical trends in merchandise returns and reduces sales and merchandise costs accordingly. The Company accounts for membership fee revenue, net of refunds, on a deferred basis, ratably over the one-year membership.

The Company’s Executive members qualify for a 2% reward on qualified purchases (up to a maximum reward of approximately $1,000 per year), which can be redeemed only at Costco warehouses. The Company accounts for this reward as a reduction in sales. The sales reduction and corresponding liability (classified as accrued member rewards in the consolidated balance sheets) are computed after giving effect to the estimated impact of non-redemptions, based on historical data. The net reduction in sales was $1,394, $1,281, and $1,172 in 2018, 2017, and 2016, respectively.


Revenue Sept. 2, 2018 Sept. 3, 2017 Aug. 28, 2016
($ millions)

Net Sales $138,434 $126,172 $116,073
Membership fees 3,142 2,853 2,646
Total revenue $141,576 $129,025 $118,719


Current Liabilities ($ millions) Sept. 2, 2018 Sept. 3, 2017

Accounts payable $11,237 $9,608
Accrued salaries and benefits 2,994 2,703
Accrued member rewards 1,057 961
Deferred membership fees 1,624 1,498
Other current liabilities 3,014 2,725
Total current liabilities $19,926 $17,495

Which of the following statements best explains in layman terms how Costco accounts for the cash received for its membership fees?

a. Because Costco does not know how many of its members will continue to the end of the year, cash received from members is recorded as a liability and recognized as revenue only at year-end.
b. When it receives cash, the company records it as a current liability. Then, it recognizes revenue evenly over the year.
c. The company records revenue when the cash is received.
d. Because Costco has a refund policy, the company records revenue when the cash is received, less an allowance for expected membership terminations.

Answers

Answer:

Which of the following statements best explains in layman terms how Costco accounts for the cash received for its membership fees?

b. When it receives cash, the company records it as a current liability. Then, it recognizes revenue evenly over the year.

Explanation:

The first part of the question clearly states that Costco reports membership fees as unearned revenue. As time passes, and the fees are accrued, it recognizes them as earned revenue. Since the membership fees last for a year, Costco recognizes the revenue associated to them evenly throughout the whole year.

Membership fees are not static, as some fees expire, new ones are received. That is why the membership fees account does not vary significantly during the year, but instead it should follow a relatively stable path.

Jacqul makes $35 an hour working as an accounting assistant. She works 40 hours each month.

Answers

Answer:

35x40=1,400

Explanation:

jacqul will make 1,400 dollars per month or 16,800 a year

Answer:

9800

Explanation:

35x40=1400

1400x7=9800

According to the Law of Supply and Demand, what will happen when supply increases?

A Quantity supplied will decrease
B Demand will decrease
C Productivity will decrease
D Prices will decrease

Answers

D when supply goes up prices go down

Many companies have a _____ that their employees are responsible for abiding by. code of unethics code of ethics set of rules set of laws

Answers

Answer:

Code of Ethics

Explanation:

Answer: B) code of unethics

Explanation:

Jenny is a sales manager who is preparing a performance review about one of her employees. The employee hasn’t been achieving his sales targets for the past several months. Jenny must use an objective___in report. Also, she must aim to be ___ of the employee while conveying the negative feedback.

Question 1 options
•convention
•style
•tone
Question 2 options
•critical
•respectful
•scornful

Answers

Answer:

Question 1) Tone

Question 2) Respectful

Explanation:

Jenny must use an objective tone in the report. Also, she must aim to be respectful of the employee while conveying negative feedback. The correct option for question 1 is c and question 2 b.

What is feedback?

Feedback can be understood as that which occurs when outputs of a system are routed back as inputs as part of a chain of cause-and-effect that forms a circuit or loop. The system can then be said to feed back into itself.

There are two types of feedback, positive and negative. Positive feedback means if the signal feedback from the output is in phase with the input signal, the feedback is called positive feedback. While negative feedback means if the signal feedback is of opposite polarity or out of phase by 180° with respect to the input signal, the feedback is called negative feedback.

The terms "positive" and "negative" were first applied to feedback prior to WWII.

Learn more about feedback, here:

https://brainly.com/question/26994432

#SPJ2

Exercise 10-19 (LO. 4) Candlewood LLC started business on September 1, and it adopted a calendar tax year. During the year, Candlewood incurred $6,500 in legal fees for drafting the LLC's operating agreement and $3,000 in accounting fees for tax advice of an organizational nature, for a total of $9,500 of organizational costs. Candlewood also incurred $30,000 of preopening advertising expenses and $24,500 of salaries and training costs for new employees before opening for business, for a total of $54,500 of startup costs. The LLC wants to take the largest deduction available for these costs. If required, round any division to six decimal places and use in subsequent computations. Round your final answers to the nearest dollar. How much can Candlewood deduct as organizational expenses

Answers

Answer:

deduction for organizational expenses = $5,000

Explanation:

Since the total startup costs are over $50,000 then the company's deduction will be lower. Generally speaking, a company can deduct up to $5,000 in organizational an startup costs ($5,000 each). But if the costs are over $50,000, then your deduction will be reduced by $1 for each dollar over that threshold.

In this case, organizational costs were $9,500, so they can deduct $5,000 during the first year and $4,500 will be amortized over the next 15 years. Startup costs are $54,500, which means that they can only deduct $5,000 - ($54,500 - $50,000) = $500 during the first year. The remaining $54,000 must be amortized over a 15 year period. Total deduction during the first year = $5,000 + $500 = $5,500

motors are packaged for sale in a certain warehouse. The motors sell for $100 each, but a double-your-money-back guarantee is in effect for any defectives the purchaser may receive (i.e. the seller pays buyer $200 for any defective item). Find the expected net gain for the seller if the probability of any one motor being defective is 0.08. (Assume that the quality of any one motor is independent of that of the others.) Show all work by defining the variables of interest and its distributions.

Answers

Answer:

$840

Explanation:

the question misses an important detail, number of motors.

I used 10 as the total number of cars. from the solution i believe you would be able to solve any other problem of this sort yourself.

n = 10

p = 1-probability of any 1 motor being defective

= 1-0.08

= 0.92

going further in solving this problem, i will use the binomial distribution

we have expected value as;

Σxp(x)

= $100 x p(of 100) - $100 x p(of losing 100)

= 100(0.92) - 100(0.08)

= 92 - 8

= $84

from here we multiply 84$ by n

remember n =  total number of cars = 10

10 x $84

= $840

Four finalists have been selected for a job as a travel agent. Which candidate will most likely get the job?
O Daniel, who has an associate's degree in hospitality and tourism management and has traveled around the world
for recreational purposes.
O Susan, who has a certificate in reservation systems used by travel agencies and has completed a six-month
internship at a travel agency
O Robert, who has a bachelor's degree in hospitality and tourism management and has completed a six-month
internship at a travel agency
O Stephanie, who has a high school diploma, experience traveling, and has worked as a part-time assistant at a
local travel agency for three years.

Answers

Answer:

A

Explanation:

plz brainlest

Among the four finalists, the candidate who has been chosen as one for the role of the travel agent is Daniel who has an associate's degree in hospitality and tourism management and has traveled around the world. Hence, option A is appropriate.

What is the role of a Travel Agent?

The role of a travel agent is very important nowadays, especially in times when the whole world is reeling under pressure and continuous understanding of things. The most important development over here has to be understood in a variety of ways. The most important of the following things is to clearly understand the notion and understanding of the place where one is targeted to go.

The other most important thing regarding the role of the Travel agent is to carefully understand the requirements of the customers who are willing to travel. To arrange for their own needs and also to make a requisite number of arrangements for the following things.

The other most important thing regarding the role of travel agents is to carefully supervise the hotels, and the travel accommodations- i.e, the transportation and all. The Role of a travel agent is to properly arrange a packaged tour for the same.

Learn more about the role of travel agents here:

https://brainly.com/question/22212490

#SPJ2

Richards Corporation uses the weighted-average method of process costing. The following information is available for October in its Fabricating Department: Units: Beginning Inventory: 88,000 units, 70% complete as to materials and 20% complete as to conversion. Units started and completed: 266,000. Units completed and transferred out: 354,000. Ending Inventory: 34,000 units, 40% complete as to materials and 15% complete as to conversion. Costs: Costs in beginning Work in Process - Direct Materials: $37,200. Costs in beginning Work in Process - Conversion: $79,700. Costs incurred in October - Direct Materials: $646,800. Costs incurred in October - Conversion: $919,300. Calculate the equivalent units of materials.

Answers

Answer:

$1.86072 per unit

Explanation:

Equivalent unit of material = Units completed and transferred out + Ending Inventory

Equivalent unit of material = 354,000 + (34,000*40%)

Equivalent unit of material = 354,000 + 13,600

Equivalent unit of material = 367,600

Cost per equivalent unit of material = ($37,200 + $646,800) / 367,600

Cost per equivalent unit of material = $684,000 / 367,600 units

Cost per equivalent unit of material = $1.86072 per unit

1. (30 points) Please elaborate what will happen to Net Earnings to Sales and Net Earnings to Total Book Assets when you observe these trends. (a) and (b) are separate unrelated circumstances. a) Sales increased by a total of 30% in the prior three years, while Days of Sales in Inventories increased also by 30% in each of these three years. Costs of Goods Sold to Sales remained constant. b) Gross property, plant, and equipment increased by a total of 30% during the prior three years. Operating and administrative expense increased relative to sales by 30% in the prior three years. Sales remained constant. Costs of goods sold to sales remained constant. ANSWER:

Answers

Answer:

Impact on Net Earnings to Sales and Net Earnings to Total Book Assets:

a) A company's Net Earnings to Sales and Net Earnings to Total Book Assets will increase due to the 30% increase in sales.  This result will be different with an increase by a similar margin in the Cost of Goods Sold.

b) Net Earnings to Sales and Net Earnings to Total Book Assets will decrease by 30% as a result of the increase in Property, Plant, and Equipment, because this increase also increased the operating and administrative expense (depreciation), even though Sales and Cost of Goods Sold remained constant.

Explanation:

The net earnings to sales is an expression of the ratio of the net income to the sales revenue.  The net earnings result after deducting all costs from sales revenue.  The net earnings to total book assets are the same expression as the Return on Assets.

What is a sales lead?
A. An employee on the customer service team who deals with existing customers
B. A sales person who works on a residual commission structure
C. An expert in Maslow's hierarchy of needs
D. A potential customer who has shown interest in the company's product
Please select the best answer from the choices provided

Answers

Answer:

D.

A potential customer who has shown interest in the company's product

Explanation:

edge. 2021

A potential customer who has shown interest in the company's product is a sales lead. Thus, option D is correct.

What is a sales lead?

A possible sales relationship, person, or business that indicates interest in your services or products is known as a sales lead. Leads are often acquired through being referred by an existing client or by responding directly to press or promotion.

The phrase refers to a prospective buyer who now has taken part mostly in the company’s products. This indicates that if a purchaser is offered the right incentives and incentives, he may readily sign up as a client of the business.

Where the person has shown interest in buying the product therefore this person will be considered a prospective consumer. Therefore, option D is the correct option.

Learn more about sales lead, here:

https://brainly.com/question/1400724

#SPJ2

Sandhill Company issued $396,000 of 10%, 20-year bonds on January 1, 2020, at 102. Interest is payable semiannually on July 1 and January 1. Sandhill Company uses the effective-interest method of amortization for bond premium or discount. Assume an effective yield of 9.7705%. Prepare the journal entries to record the following. (Round intermediate calculations to 6 decimal places, e.g. 1.251247 and final answer to 0 decimal places, e.g. 38,548. If no entry is required, select "No Entry" for the account titles and enter 0 for the amounts. Credit account titles are automatically indented when amount is entered. Do not indent manually.)
(a) The issuance of the bonds.
(b) The payment of interest and related amortization on July 1, 2020.
(c) The accrual of interest and the related amortization on December 31, 2020.

Answers

Answer:

01-Jan-20

Dr Cash 403,920

Cr Premium on Bonds Payable $7,920

Cr Bonds Payable $396,000

01-Jul-20

Dr Interest Expense $19,602

Dr Premium on Bonds Payable $198

Cr Cash 19,800

31-Dec-20

Dr Interest Expense $19,602

Dr Premium on Bonds Payable $198

Cr Interest Payable $19,800

Explanation:

A. Preparation of Journal entry for the issuance of the bonds

01-Jan-20

Dr Cash 403,920

($396,000 x 102/100)

Cr Premium on Bonds Payable $7,920

(403,920-396,000)

Cr Bonds Payable $396,000

(To record issuance of bond)

B. Preparation of the Journal entry for the payment of interest and related amortization on July 1, 2020.

01-Jul-20

Dr Interest Expense $19,602

(19,800- 198)

Dr Premium on Bonds Payable $198

($ 7,920 / 40 semi annual payments)

Cr Cash 19,800

($396,000 x 10% x 6/12)

(To record interest payment)

C. Preparation for he accrual of interest and the related amortization on December 31,

31-Dec-20

Dr Interest Expense $19,602

(19,800- 198)

Dr Premium on Bonds Payable $198

($ 7,900 / 40 semi annual payments)

Cr Interest Payable $19,800

($396,000 x 10% x 6/12)

(To record interest accrual)

Fandry Company has obtained the following data concerning a new product: Production Costs, Using traditional costing method $3.00 per unit Production Costs, Using activity-based costing method $5.00 per unit Nonproduction Costs, Using activity-based costing method $2.50 per unit Fandry Company wants the price of the new product to cover all costs plus a 100% markup. The production process used for the low volume product is very complicated and it has a higher proportion of indirect costs than direct costs. What price per unit should Fandry Company charge for the new product

Answers

Answer:

$15.00 per unit

Explanation:

Calculation for the price per unit that Fandry Company should charge for the new product

Using this formula

Price per unit for new product =Production Costs, Using traditional costing method per unit ×

Production Costs, Using activity-based costing method per unit

Let plug in the formula

Price per unit for new product=$3.00 per unit ×$5.00 per unit

Price per unit for new product=$15.00 per unit

Therefore the price per unit that Fandry Company should charge for the new product will be $15.00 per unit

Other Questions
Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations