Some ways that you can determine information is reliable or trustworthy

Answers

Answer 1
See others people comment about it or like ask someone and see if they also have the same "answer"

Related Questions

Were there _________students at the debate?
(a) much (b) a lot (c) much more (d) many​

Answers

D is the correct one

BTW IM IN 5th GRADE SO USE A KID APPROPIATE BOOK LIKE RAMONA QUIMBY.Create an interview with a character from a favorite book. Incorporate at least five spelling words into your interview. Interview should include questions from the Interviewer and answers provided by the perspective of the character. Spelling words must be spelled correctly, underlined, and used correctly within the context of the interview.

inaccurate
inactive
incomplete
incumbent
indefinite
indict
introvert
invisible
*subject
*suddenly

Answers

Answer:

inaccurate

your answer is inaccurate .Can you answer it again?

inactive

why you are inactive in sports?

incomplete

your answer is incomplete. Give complete answer.

incumbent

what's your incumbent in everyday life?

indefinite

what is indefinite number?

indict

what is the meaning of indict?

introvert

what is your bad introvert ?

invisible

which object is invisible?

Which of the following best explains why the author chose this point of view?






Answers

Answer:

IF THERE IS A LINK DON'T ANSWER IT

Explanation:

IT'S A COMPUTER PHONE AND TABLET VIRUS

Battle in your own words sentences

Answers

Answer: We lost many men in the long-lasting battle but in the end, we won. Our bruises and blood were washed away from the glory of winning. The death of our brothers was not in vain.

I will give Brainiest if you answer this

(List 3 facts you learned about koalas)

Answers

Answer:

Koalas aren't bears – they're marsupials! ...

Koalas can sleep up to 18 hours a day

Koalas can be found in southeastern and eastern Australia. ...

Explanation:

there ya go. Mark brainliest plz. i fixed it

1) Koalas are found in the eucalyptus forests of eastern Australia. They have grey fur with a cream-coloured chest, and strong, clawed feet, perfect for living in the branches of trees!

2) Cuddly critters, koalas measure about 60cm to 85cm long, and weigh about 14kg.

3) Although you may have heard people call them koala ‘bears’, these awesome animals aren’t bears at all – they are in fact marsupials. A group of mammals, most marsupials have pouches where their newborns develop.

Which of the following sentences contains both an independent clause and a subordinate clause?
A Coiled under a rock was a large rattlesnake.
B. When he finished eating, Manny cleared his plate.
C. Lila yelled for help, and someone came to rescue her.
D. The children scrambled up the ladder and slid down the chute.

Answers

Answer: B

Explanation:

YOUR OWN
Which group of Arthropods is known as the Marine animal?​

Answers

Answer:

Crabs. Crabs belong to the subphylum Crustacean, the largest group of marine arthropods, which also includes lobster, shrimp, and krill, a shrimp-like crustacean. Crabs move sideways, walking on four pairs of legs, and holding their two legs with claws away from their body.

Dolphins. Just dolphins

Which examples demonstrate common Transportation Operations work environments? Check all that apply.
Lori is a self-employed worker who owns a taxi and spends most of her time driving it
Moses works at pollution sites, helping to clean them up.
Vida works in an airport control tower, directing airplanes as they take off and land.
Ivan works on a large ship, away from land for long periods of time
Jordan works in a repair shop, fixing engines.
Rosemary works in a warehouse, preparing materials for shipping.

Answers

Answer:

A,C,D

Explanation:

Answer:

acd

Explanation:

mans above me i right 2021 edge

Which of the following is an Informal definition of hot dog?
The use of hot dog to describe someone showing off their athletic skills dates back to the surfing culture of the 1960's.
Some suggest it came about because beachgoers would eat hot dogs while watching the action offshore.
Worried that the high-spirited skiers would hurt someone while goofing around and showing off their moves, the ski patrol
shouted at them to stop the hot dogging.
Hot dog is a versatile word that may be a noun referring to a mild sausage, a verb meaning to perform in a flashy manner,
or even an interjection expressing excitement or pleasure.
O Dogs ranked: 1) real dogs, 2) bagel dogs, 3) hot dogs.

Answers

''Worried that the high-spirited skiers would hurt someone while goofing around and showing off their moves, the ski patrol shouted at them to stop the hot dogging'', is the example of an informal definition of a hot dog. Therefore, the option C holds true.

What is the significance of an informal definition?

Such definitions that describe about a particular topic or a subject without following a standard set of rules or processes are often known as informal definitions. Informal definitions are not the conventional methods of defining any given subject.

An informal definition for hot dog is the one mentioned above. It is an informal definition, because it does not define the characteristics of a hot dog based on its appearance or contents. Rather, it uses the term in a sentence to convey the meaning of hot dog.

Therefore, the option C holds true regarding the significance of an informal definition.

Learn more about an informal definition here:

https://brainly.com/question/23432441

#SPJ2

Which of the following would not be a good supporting sentence for an
illustration paragraph with the following topic sentence?
Our family is normally quiet, but every so often things can
go haywire.
A. We spent the rest of the night hooting, hollering, and creating
good-natured havoc.
B. To be honest, I prefer it when we're quiet.
c. It seems that we were all excited to begin with, and then when Dad
won the new car we couldn't contain ourselves.
D. Last year at the county fair was one of those times.

Answers

A. We spent the rest of the night hooting, hollering, and creating good-natured havoc.

Mark you want me to pick it out or do you need to know how please mark please send the address

write a essay about a visit you'll never forget​

Answers

you can write about going to a river, and how you saw a group of baby turtles, had a picnic, then went star gazing, but if you want me to write an essay, feel free to message me on discord, and i happily will

What does Gabi decide to do so that she is prepared in case she and Martin have sex on prom night?

Answers

Umm what..
Weird question but maybe shave, bring condoms, take birth control LOL WHAT

What symbols does Frost use in "The Road Not Taken"? How do these symbols help shape the deeper meaning of the poem? Retell the "story" in light of the symbols. Write a paragraph of at least 125 words.

Answers

Answer:

Frost uses his conflict of having to choose between two paths as he was walking through the woods one day; the path more or less traveled. The paths in the woods that Frost spoke of in his poem symbolize the routes you can take in life. This makes the poem's meaning deeper by causing the audience to relate making choices in your life to something as insignificant as choosing which path to take as you walk through the forest. Frost even goes so far as to say he may come back to that spot and choose the path he hadn't before, then going on to say that it wouldn't be likely as the path he chose will likewise lead him down more and more paths with more and more choices. This poem is ultimately of a person going through life when he comes to a crossroad, a moment where he must choose between two choices, the choice more or less popular. He thinks for a bit before starting down the path less traveled, or the choice less popular. He then thinks that perhaps he'll come back to that spot in life again one day before acknowledging that it very well may never happen as the choice he chose will bring him to other paths or choices to be made in his life. In the poem, he even goes so far as to say that the choice he made of choosing the less popular choice rather than the more popular one has led him to where he is today, which holds true, literally and figuratively.

Which transition would BEST clarify the relationship between the claim and the evidence in these sentences?

Answers

Answer:

C - In Fact

Explanation:

10 PRACTICE MAKES PERFECT Write a story of 200-250
words. Your story must end with this sentence.
It had been the most surprising thing that had ever
happened to them, and probably ever would.
WRITING BANK PAGE 154

Answers

Answer:

Sophia's life flashed before her eyes. "Jessica! Jessica help me up!" Sophia's fingers were sliping. If Jessica didn't help her out Sophia would fall to her doom.

"No way! You stole Daniel from me and now you must pay!" Jessica roared.

Sophia scream right back at her, "I did not! He is my best friend! That's all we are! Please- AHHH!!!" Sophia hung only by one hand. She had tears running down her face. All she had done was hug Daniel. 2 fingers left on the cliff and Jessica still didn't care. "Jessica help me! Please! I'll explain everything!"

Jessica looked at Sophia. She noticed how honest and weak she looked. She grabbed Sophia's arm and hauled her up. "Start speaking before I push you off this mountain."

"I've been friends with Daniel since I was 5. He is a brother to me. Jessica, I would NEVER love him any other way. Please, believe me. You can push me off now that you heard me." Sophia as trustworthy as ever stood there. Knowing that Jessica would push her off.

"Can you forgive me Sophia?"

"I'll always forgive you. No matter what you do."

"In that case..." Jessica pushed Sophia of the cliff.

It had been the most surprising thing that had ever happened to them, and probably ever would.

PLEASE GIVE ME A GOOD OPENING FOR A COMPARE AND CONTRAST ESSAY WILL MARK BRAINLIEST

I am writing a compare and contrast essay about Noor Inayat Khan and Malala Yousafzai

Answers

Malala is a Pakistani education advocate who, at the age of 17, became the youngest person to win the Nobel Peace Prize after surviving an assassination attempt by the Taliban. Surviving a shot to the head, Malala now travels all over the world to speak out on the importance of education for women. She has published her own book, I Am Malala, and won the Nobel Peace Prize in 2014. 

“I raise up my voice-not so I can shout but so that those without a voice can be heard...we cannot succeed when half of us are held back.” -Malala

Noor Inayat Khan 

Nicknamed The Spy Princess, Noor was a descendant of Indian royalty raised in Britain and France. The elite Special Operations Executive recruited her in 1942 to work as a radio operator because of her bilingual abilities. Serving as a spy during World War II, she faced imprisonment, torture, and was eventually killed at Dachau concentration camp. Considered a British heroin of World War II, a statue of her is located in Gordon Square Gardens, London, to commemorate her bravery and service.

dose some one know what's the squar root of 81???

Answers

Answer:

9

Explanation:

9 times 9 is 81

Answer:

9

Checking Work: [tex]9^{2}[/tex] = 81

These men insist that Pi make a decision. What choice are they asking him to make?

Answers

Answer:

They insist that he tell them the true story

Explanation:

that they tell them a true story

Does The relatively recent resurgence of the death penalty in the late 80s in Alabama concern you?

Answers

Answer:

Since its an opinion question you can say something like this: "It does concern me as some people may be falsely accused of crimes they haven't committed, as cases and scenarios of those have occurred. Before its too late to prove innocence the inmate would have already been executed."

Are you the person in charge here ____

Answers

Answer:

for gaurd

Explanation:

incharge means that it is in an work so work might be gaurd or manager

hope it helps you

please mark me as brainlist

I think so hope that helps I hope you have a wonderful day

1. Choose the appropriate word to replace the boldfaced word in the following sentence: The starving lion tracked its prey with desperate ferocity. (1 point)

gallant
quarry
fetter
increment

2. “The Armenian Language is the Home of the Armenian” seeks to (1 point) inform.
criticize.
persuade.
satirize.

3. Which of the following is not an example of irony from “Behind the Veil”? (1 point) Ihsan attempts to seduce veiled girls.
Girls in veils appear more alluring than those who walk unveiled.
The veil gives Siham power over Ihsan.
Siham’s father praises her devotion to the veil.

4. Choose the appropriate word to replace the bold-faced text in the following sentence: Not wanting to hurt her feelings, I replied thoughtfully when she asked me how her ridiculous hat looked. (1 point)
judiciously
imploringly
precariously
ingratiatingly

5. Which of the following is not a conflict in “Five Hours to Simla?” (1 point)
self vs. self self vs. nature
self vs. other
self vs. supernatural

6. Which best describes the theme of “The Cabuliwallah"? (1 point) Friendship is possible between people of different cultures.
The similarities between people are often much more important than their differences.
Change happens.
You never know what a stranger is like until it is too late.

7. The narrator in “Sweet Like a Crow” does not use similes in the poem to express (1 point)
anger at another critic.
his culture’s sense of music and rhythm.
identifying features of his culture.
his admiration for his own work

8. The focus of the burden of truth-telling moves from _________________ in “Like the Sun.” (1 point) Sekhar to his wife
the pain it causes to the healing
it brings Sekhar to the headmaster
a metaphor to a reality

9. Choose the appropriate word to replace the bold-faced text in the following sentence: The inspector closely examined the crime scene for clues. (1 point) ingratiated
implored
impended
scrutinized

For questions 10–12, choose the verb that correctly completes the sentence.

10. The bark of cork trees (has, have) many commercial uses. (1 point) has
have

11. Both cats and monkeys (has, have) tear ducts. (1 point)
has
have

12. In the Blue Ridge Mountains (are, is) many summer camps. (1 point) are
is

Answers

Answer:

IF THERE IS A LINK DON'T CLICK ON IT

Explanation:

IT'S A COMPUTER PHONE AND TABLET VIRUS

Hi
I wanna presentation for 5 minutes can you choose a good topic

Answers

Answer:

so like anything?

Explanation:

hmmm???????????..............

eeeeeee halp meghhh. Reeee

Answers

the first one is a haiku, it has the patterns of syllables 5,7,5

"Master", I said "this sayings had for me."


This sentence primarily reflects the role of
A. Dante as Pilgrim
B. Dante as Poet
C. Virgil as guide
D. Virgil as teacher

Answers

Answer:

B. Dante as Pilgrim

Explanation:

Hope this helps!

Answer:

the answer is d

Explanation:

Veronika and the other girls in her dance class took their places on stage. Veronika looked over at her friend Daniela. They smiled at each
ther
"Take a deep breath," Daniela whispered to Veronika.
The music began and the stage curtain went up. Veronika's heart was a pounding drum as she looked out at the sea of faces. She hoped sh
mouldn't mess up her steps.
Vhat does the metaphor heart was a pounding drum tell the reader about Veronika?
1. Veronika is tired from practicing the dance.
2. Veronika's heartbeat is like the waves on the sea.
3. Veronika is excited to dance with Daniela on the stage.
4. Veronika is nervous about performing in front of an audience.

Answers

Answer:

4. veronika was nervous to preform

Explanation:

drums make a bom bom sound and giving that description to the heart makes it seem like it is pounding very fast and it usually does that when you are nervous or you just finished working out

How do the structures of "It Sifts from Leaden Sieves" and "The Snow-Storm" affect the poems?
O
The longer lines and stanzas in "The Snow-Storm” suggest a very wind-driven, active snowfall and a more active
response, the shorter lines and stanzas in "It Sifts from Leaden Sieves” suggest a gentler snowfall and a gentler response.
O
The shorter lines and stanzas in "It Sifts from Leaden Sieves" suggest a rush toward getting out in the snow, the longer
lines and stanzas in "The Snow-Storm” suggest a long wait inside.
O
The shorter lines and stanzas in "it Sifts from Leaden Sieves" suggest a very quiet and timid approach to the snowfall; the
longer lines and stanzas in "The Snow-Storm" suggest a violent approach to a raging storm
The longer lines and stanzas in “The Snow-Storm” suggest the feelings of fear in those subjected to the storm; the shorter
lines and stanzas in "It Sifts from Leaden Sieves" suggest an eager approach and a love of the snow.

Answers

Answer:

How do the structures of "It Sifts from Leaden Sieves" and "The Snow-Storm" affect the poems?

The longer lines and stanzas in “The Snow-Storm” suggest a very wind-driven, active snowfall and a more active response; the shorter lines and stanzas in “It Sifts from Leaden Sieves” suggest a gentler snowfall and a gentler response.

The longer lines and stanzas in “The Snow-Storm” suggest the feelings of fear in those subjected to the storm; the shorter lines and stanzas in “It Sifts from Leaden Sieves” suggest an eager approach and a love of the snow.

The shorter lines and stanzas in “It Sifts from Leaden Sieves” suggest a rush toward getting out in the snow; the longer lines and stanzas in “The Snow-Storm” suggest a long wait inside.

The shorter lines and stanzas in “It Sifts from Leaden Sieves” suggest a very quiet and timid approach to the snowfall; the longer lines and stanzas in “The Snow-Storm” suggest a violent approach to a raging storm.

Explanation:

I took the quiz.

Answer:

It is answer B

Explanation:

The longer lines and stanzas in "The Snow-Storm” suggest a very wind-driven, active snowfall and a more active

response, the shorter lines and stanzas in "It Sifts from Leaden Sieves” suggest a gentler snowfall and a gentler response.

Any tips on how to write an essay? For example, transition words, how many sentences, steps, and like the format of an essay? Mostly if someone can tell me the format it would be best. Thanks. Brainliest will be given for the most info. Also, if you can, how to cite a source or information? Thanks

Answers

Answer: Pick a topic. You may have your topic assigned, or you may be given free reign to write on the subject of your choice. ...

Prepare an outline or diagram of your ideas. ...

Write your thesis statement. ...

Write the body. ...

Write the introduction. ...

Write the conclusion. ...

Add the finishing touches.

Explanation:

Answer:

Use transition words like, therefore, in addition, additionally, hence. If your trying to include evidence use, "the text states", "according to the text" "the text proves" and so on.

Explanation:

Hope it helps :)

Which of the following statements best describes a major theme of the poem? Mother to Son Poem.

Answers

Answer:

"Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

Explanation:

hope i answer your question right

"Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

What is noun?

The best definition of an appositive is a noun or noun phrase that modifies a noun. This grammatical construction usually sits next to another noun and modifies it by renaming it or describing it in another way. Appositives are generally offset with commas or dashes. For example: My best friend, Gary, lost his keys.

Common nouns are nouns that name a class of person, place, thing, animal or event in a general way (they do not refer to someone or something in specific as proper nouns do), and that are not to be capitalized unless they begin a sentence or are part of a title. The term report, then, is a common noun because it refers to a class of thing or of piece of information, and is not to be capitalized.

Therefore, "Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

Learn more about  crystal on:

https://brainly.com/question/13008800

#SPJ2

Living in a/an________society teaches many important things. There are different people and various ideas from many different countries, races or religions. By this way, you can understand people from different_________better

A) ancient / generation
B) unique /nations
C) multicultural /nations
D )mystic / generations​

Answers

Answer:

C) Multicultural/nations

Explanation:

Living in a multicultural society teaches many important things. There are different people and various ideas from many different countries, races or religions. By this way, you can understand people from different nations better.

not sure but here you go!!

Please Help 50 POINTS!!!!! Read the excerpt. Which phrase best completes the sentence?

In the second paragraph, the author's use of flashback creates a sense of mystery about
.

Answers

I can cross out the first and last one and between the two left I think it’s the one about the friendship because the flashback includes that they were friends when younger and the person with illness only had that one friend which in my opinion adds mystery about the friendship. So basically the 3rd one about friendship.

The first and last one and between the two remaining I believe it's the one about the kinship on the grounds that the flashback incorporates that they were companions when more youthful and the individual with sickness just had that one companion.

What is flashback of story?

Albeit the text of the story you are alluding to is excluded with the inquiry, we can in any case attempt to figure out what the utilization of flashback typically achieves in a text.

A flashback alludes to a break in a story. In this interference, a writer embeds previous occasions to give foundation data that permits the peruser to comprehend the story better.

In this way, there are a few things that an essayist should achieve by embedding a flashback in a story. He should give more data on a person. He could likewise need to permit the peruser to more readily get the setting of the story.

For more information about Flashback, refer the following link:

https://brainly.com/question/2590177

Other Questions
if it costs 21.6$ for 12 brownies, how much would it cost for 1 Isaac paid $81 for a new surfboard. The amount paid was 60% of his total savings. How much money did he have in his savings before buying the surfboard? help btw it needs to be rounded to the hundredths BRAINLIEST IF CORRECT which evidence best supports the following topic sentence? Another reason the school should open an after school computer lab is that the lab would offer safeguards for internet use that students do not get out of school. Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Steam Workshop Downloader