The water cycle plays an important role in an environment because

Answers

Answer 1

Answer:

it gives us water and it helps all our thing in the envierment grow and help us live.


Related Questions

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Answers

Explanation:

1. b-a-c

2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.

3. Helicase

4. DNA Polymerase

5. Option D

6. Option C

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

Why is it we cannot directly observe a genotype, but can sometimes infer it?

Answers

We cannot directly observe a genotype because there are multiple options for genotypes.

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

Help me with this please

Answers

C can be the possible answer!

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________

Answers

Answer:

vibrating vocal cords, stomping feet, gargling, whistling, cracking your knuckles

Answer:

•shouting•talking•singing•playing instruments•laughing•yelling•screaming•crying

Explanation:

yAn LNG po Alam ko e:^

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

State one way by which Carbon Dioxide decreases in the atmosphere

Answers

Answer:

The early atmosphere was mainly carbon dioxide and water vapour. Water vapour condensed to form the oceans. Photosynthesis caused the amount of carbon dioxide to decrease and oxygen to increase.

Hope it helps!!!

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%

Answers

Answer:

C, 10%

Explanation:

For the year of 2010, it's definitely 10%

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. ... The G2 checkpoint ensures all of the chromosomes have been replicated and that the replicated DNA is not damaged before cell enters mitosis.

A mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Tumor suppressor genes are normally expressed genes that control the progression of a cell through the cell cycle.

These genes (tumor suppressor genes) act to repair mutations that occurred during DNA replication, slow down cell division, activate programmed cell death pathways (i.e., apoptotic pathways, etc).

For example, p53 is a tumor suppressor gene capable of controlling cell division rate by keeping cells from proliferating in an uncontrolled manner.

In consequence, mutations of the p53 gene are often observed in cancer cells that lost their ability to regulate the rate at which they grow.

In conclusion, a mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Learn more in:

https://brainly.com/question/16188646

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea

what does not pass through the stomata of leaves ​

Answers

Carbon dioxide and oxygen cannot pass through but move in and out

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

Other Questions
At a carnival game, you randomly throw two darts at the board and break two balloons. There are 15 balloons in total, 4 of them being purple. What is the probability that both the balloons you break are purple? Write your answer as a fraction. What is the best choice for the common denominator in this problem?1/5 + 2/6 6. One advantage of an enclosed office layout is that employees can be closelymonitored/supervised.TrueFalse Which design principle will you apply if you group similar elements together when designing a magazine cover?A. repetitionB. contrastC. alignmentD. proximityE. grid system What does this mean? vives cerca de un parque? Corres al parque todos los dias por la manana? help me plzzzzzzzzzzzzzzzzzzzzz What is the value of y for the problem (2y + 20)? ANSWER QUICKLY - I WILL GIVE BRAINLIEST! Please helppp! Do you think its possible to count all the organisms in an ecosystem using these methods? Explain your answer. ( talking about canopy fogging, quadrat sampling, transect sampling, and netting!) help please this is kinda difficult . When the data points on a graph shows a steady trend and it upward direction there is what? Why are bacteria called the borderline between plants and animals I need talk kung pwede kayo Emma buys 9 bottles of pineapple juice at the corner store for a total cost of $10.62.Assume each bottle of juice is the same price. If c represents the total cost in dollarsand cents of the juice for any number, j, of bottles of juice, write a proportionalequation for c in terms of j that matches the context. Which biome do you think had the most biodiversity? Why? going to the movies is an example of what types of expenses? Plz help its due tonight!!! Which of the following is an example of how people take ownership of space? label the longitudinal wave HELOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO a piece rate worker is paid Steam Workshop Downloader