*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer 1

Answer:

which are the letters with hightlight yellow?


Related Questions

State three factors affecting breathing rate in human beings​

Answers

Answer: age, smoking habits, and size/weight

Explanation:

The older you get, the weaker you'll be, so your breathing will be effected.

If you smoke then your lungs will be effected which will ultimately have an affect your breathing.

If you're really heavy (ex. Over weight) then you will get tired more easily, which will effect your breathing rate.

Hey :)))))))6))usifheidh

I NEED HELP ASAP! (Picture is attacted) You Dha Real One IF YOU DO!

Answers

I think your answer is C


Why is the series of reactions in the Calvin cycle called a
"cycle”?

Answers

Answer:

You can think of the Calvin cycle as being somewhat like a sugar factory within a chloroplast. It is called a cycle because, like the Krebs cycle in cellular respiration, the starting material is regenerated each time the process occurs. In this case, the starting material that gets regenerated is a compound called RuBP, a sugar with five carbons.

With each turn of the Calvin cycle, there are chemical inputs and outputs. The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH. The cycle's output is an energy-rich sugar molecule. That sugar is not yet glucose, but a smaller sugar named G3P. The plant cell uses G3P as the raw material to make glucose and other organic molecules it needs.

Explanation:

You can follow the process of the Calvin cycle in the figure.

The series of reactions in the Calvin cycle are called a cycle because it involves inputs and outputs.

The Calvin cycle simply refers to the process that algae and plants use in turning carbon dioxide into sugar. The Carbon cycle is made up of steps such as Carbon fixation, reduction phase, carbohydrates formation, and the regeneration phase.

The series of reactions in the Calvin cycle are called a cycle because it involves inputs and outputs. The input molecules are ATP, carbon dioxide, and NADPH. On the other hand, the output molecules are ADP, sugar, and NADP.

Read related link on:

https://brainly.com/question/2366899

.

Give an example of a hypothesis not mentioned.

Answers

an observation is when you have a material in front of you and you are reviewing the info a hypothesis is before you really know anything about this subject and you were making kind of like predictions i hope this helps

1. Law is something that has been proven through experimentation. theory is a hypothesis that is supported by laws (facts.)

2. An Observation is info that you log through your senses. A hypothesis is what you predict will happen based on your Observations.

3. Examples not given.

a drawing or diagram is an example of a(n) ____ model.​

Answers

Can you please add the picture of that model that which type of you want

Explain and describe complex inheritance.

Answers

Answer:

Complex Inheritance: (inherited) traits that have a genetic component that does not follow strict Mendelian inheritance. May involve the interaction of two or more genes or gene-environment interactions. ( HGPIA)

Explanation:

When two molecules are put in the same container they do not attract each other. Why does this happen?

a.they are both polar
b. they both contain oxygen
c. one is polar one is nonpolar
d. they contain different elements

Answers

D just took the test , yesterday

Answer:

The correct answer is C.

C. One is polar one is nonpolar 

Explanation:

what is the function of Motor Proteins

Answers

Answer:

Motor proteins propel themselves along the cytoskeleton using a mechanochemical cycle of filament binding, conformational change, filament release, conformation reversal, and filament rebinding.

Hope this helps :)

PLEASE ANSWER THESE QUESTIONS COMPLETELY!!! WILL MARK BRAINLIEST!!!
Questions:
A. Is the suspect guilty of the crime?
B. How do you know?

Answers

Answer:

A. No

B. because, the suspect doesn't add up to any of the DNA of the killer, victim, or the control, so no the suspect is definetly not guilty and is definetly not the killer. It just wouldn't add up right, none of the other's DNA matches to the suspect, leaving the suspect as not guilty but inisent and doesn't lead or match that suspect to in any way the killer. In other words the killer and suspect don't link in any way!

Explanation:

Hope I helped in any way that you were looking for in this answer! :)

Please sort between in animal cells in plant cells or in both.
Cell membrane
Cell wall
Cytoplasm
Mitochondrion
Chloroplasts
Vacuole
Ribosomes
Golgi Apparatus
lysosomes
Endoplasmic reticulum

Answers

Answer:

plant :cell wall,chloroplasts

animal:lysosome

both:cell membrane

mitochondria,golgi apparatus,cytoplasm,vacuole,ribosome,endoplasmic reticulum

Explanation:

What is the difference between poison and medicine? How can we use science to figure out the difference.
Will mark u brainliest.

Answers

Answer:

not sure how to go about this question so if I'm wrong please tell me

Explanation:

The difference between poison and medicine is that poison is used to harm to one's health whether its an animal or human while medicine is used to cure an illness or an injury. We can use science to figure out the difference by testing the substance on an animal or stem cells of a human scientists do this various times to be assured of its outcome.

Which is not needed for facilatated diffusion?

Answers

Answer: energy is not needed

Answer:

Chemical energy from the ATP hydrolysis in the transport stage.

Explanation:

molecules and ions move their own concentrate resulting in the radiant reflecting its nature.

100 POINTS!!!!!!!!!!! ( I NEED FAST ANSWERS ) Why do we use uranium for nuclear energy?

Answers

Answer:

Uranium is the fuel most widely used by nuclear plants for nuclear fission. ... Nuclear power plants use a certain kind of uranium, referred to as U-235, for fuel because its atoms are easily split apart. Although uranium is about 100 times more common than silver, U-235 is relatively rare.

Explanation:

i looked it up

Answer:

In a nuclear reactor the uranium fuel is assembled in such a way that a controlled fission chain reaction can be achieved. The heat created by splitting the U-235 atoms is then used to make steam which spins a turbine to drive a generator, producing electricity.

Explanation:

I pretty much covered it in the answer!

Pls Brainliest! It would mean a lot! ;)

two martians, betty and ben want to have a child. they both have one eye but are hoping to have a three eyed baby. is this possible?

Answers

Answer:Yes

Explanation:

Only if someone down their bloodline has had 3 eyes. It would be possible, but highly unlikely.

Which molecules may diffuse across a cell membrane without the expenditure of energy or the use of membrane proteins?

Answers

Explanation:

In simple diffusion, small molecules without charges such as oxygen and carbon dioxide flow through a plasma membrane without assistance and without expending energy. Other substances such as proteins, glucose and charged particles called ions cannot pass through the selectively permeable membrane

what is convection in the atmosphere called ? please answer quick !!

Answers

Answer:

Atmospheric convection.

Explanation:

Atmospheric convection is the result of a parcel -environment instability, or temperature difference, layer in the atmosphere.

Hope this helps! Have a great day! :)

Troposphere is the answer to your question

What principle can be applied to all chemical reactions?

A) conservation of mass
B) reactants formed from products
C) energy loss theory
D) coefficient principle

Answers

A. Conservation of mass

Which of the following is a molecule when broken down to a simple particle?
O gold
O nitrogen
O water
O francium

Answers

Nitrogen I believe is the right answer

Based on the phylogenetic tree, which of the following statements is true.

see the following image.

a. Species A was probably much larger than any of the other organisms
b. Species G is extinct
c. Species C is the most recent ancestor of species B and D
d. Species F and G are more closely related than Species B and E

Answers

Answer:

a

Explanation:

Answer:

CORRECT (SELECTED)

Species F and G are more closely related than species B and E.

Explanation:

Species F and G share a more recent common ancestor than species B and

compare the characteristic features of animals and plants

Answers

plants and animals are both living

some plants make there own food while animals have can not make there own food

What is the mass of the object on the triple beam balance?

Answers

Answer:

298

Explanation:

because

Answer: 167

Explanation:

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

What are bulging of eyeballs?

Answers

Answer:

bulging nose

Explanation:

3. How does ATP provide energy to your body?

Answers

Answer:

ATP(or Adenosine Triphosphate) provides energy to your body because it is a chemical that takes energy from the food you eat and turns it into energy your body can absorb. So because of this, it is considered a source of energy.

HELP PLEASE PLEASE PLEASE! ILL GIVE BRAINLIEST!

Q: What is a controlled variable? Give an example

(BTW if u can let me know if the answer is from google so I can put it in my own words, if it's not also let me know! if you don't it's fine! , works either way!)

Answers

Answer:

A control variable is the variable in the experiment that does not change.

Explanation:

If you are testing how seeds grow in different types of water, and you add 1tbps of salt to one pot of water with the plant, and then added 2tbps to another pot of water with the plant. The control variable in this experiment would be the water with no salt because it was not altered.

FYI I did not pull from google. Good luck!


Q 9. How do the heart and the lungs work together?

Answers

they work together to ensure the body has oxygen in its blood to make sure it functions properly
The heart and lungs work together to make sure the body has the oxygen-rich blood it needs to function properly. The Pulmonary Loop The right side of the heart picks up the oxygen-poor blood from the body and moves it to the lungs for cleaning and re-oxygenating.

GIVING BRAILIEST!!!!

Give an example of a cause-and-effect relationship in biology.

Answers

Answer: When water is heated, the molecules move quickly, therefore the water boils.

Explanation:

Predict what would happen to the wolf and elk populations if there was a drought that caused many of the plant species to dry up and/or die.

Answers

Answer:the elk would die because there would be no plants left and then the wolf would die to because there would be no more elk

Explanation:

If a drought were to cause many plant species to dry up and die, it would have indirect effects on the populations of wolves and elks, which are interconnected through a predator-prey relationship.

The drought leads to a scarcity of water, which affects plant growth. Many plant species, including grasses and shrubs that serve as food sources for elks, dry up and die due to the lack of water.

With the decline in plant food sources, the elk population would face food scarcity. The reduced availability of vegetation would result in limited feeding opportunities for elks, potentially leading to malnutrition and weakened individuals.

Therefore, it's important to note that the specific outcome may vary based on the severity and duration of the drought, the overall ecosystem resilience, and the presence of alternative food sources or migration possibilities for elk and wolf populations.

For more details regarding drought, visit:

https://brainly.com/question/26694292

#SPJ2

what is the relationship between heart rate & respiratory rate (impact on oxygen, carbon dioxide & energy levels)​

Answers

USE SOCRACTIC IT WOULD REALLY HELP WITH QUESTIONS LIKE THIS !!

In a phospholipid, the ionic head is _____ and the lipid tail is ______

Answers

hydrophilic; hydrophobic
Other Questions
Convert into linear equations In his garden tim plants the seed 5 1/4 in. below the ground. After one month the tomato plant has grown a total of 11 1/2 in. How many inches is the plant above the ground? During Washington's first term as president, the United States faced ongoing tensions withO Germany and Britain.O France and Canada.O France and Britain.O Britain and Canada. Can someone please help me? please answer these questions I have an f if I don't get help I will die Write a proportion for each situation. Then solve c. 25 yards in 2 1/2 seconds 100 yards in y secondd. 480 heartbeats in 4 minutes z heartbeats in 1 minute Please Help!! I Have Less Than 20 Minutes!! The graph of y = x4 - 2x2 + 1 is shown. Can anyone answer this is full sentences Ralph wants to build a rectangular deck with a predefined area of 66 feet squared. One side of the deck will be 5 feet longer than the other. To find the side lengths, he first writes the equation (x)(x+5)=66 and later simplifies (x-6)(x+11)=0 it to , where x is the length of the shorter side. Which of these are the side lengths, in feet, of the rectangular deck? Select all that apply help asap A Dog grooming service takes care of dogs by giving dogs (d) a bath, (b) (Some dogs don't require a bath) cutting its nails (n)( Assume a nail can only be cut partially and cutting their hair H (Measured as a weight in pounds )6) Which set of numbers best describes the value of the variable? Choose the most specific value.d(# of dogs) a)naturalb)wholec)integerd)rationale)irrationalf)real7)Which set of numbers best describes the value of the variable? Choose the most specific value.b (number of baths) a)naturalb)wholec)integerd)rationale)irrationalf)real8) Which set of numbers best describes the value of the variable? Choose the most specific value.n (number of nails cut. Assume only part of a nail can be cut) a)naturalb)wholec)integerd)rationale)irrationalf)real9) Which set of numbers best describes the value of the variable? Choose the most specific value.H. (wight of hair in pounds) a)naturalb)wholec)integerd)rationale)irrationalf)real Davids dialogue in response to his son shows that he *A. thinks that camping is fun.B. loves fishing on Greenville Creek.C. feels deep regret for not being around as much as he should.D. wishes that they had chosen to do something other than camping. Before you summarize, it is necessary to paraphrase? PLS IT URGENTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT!!!!!!!!!!!!!!!!!!! Define the word saving in your own words Please help me! Ill name you brainiest!!! In paragraph 8, the author uses descriptive language to indicate that [The building was Indian in design, with wide verandasopening onto a central courtyard, but Indian verandas are usuallywhitewashed, with stone floors. These, in the tradition of British schools, were painted dark brown and had matting on the floors. It gave a feeling of extra intensity to the heat]the school looked the same as Indian schoolsthe school reflected British culturethe school reflected both British and Indian culturethe school looked out of place for British and Indian people You can buy a skateboard from your friend for $60 and rent a helmet for $2 per hour. Your other option is to rent a skateboard and a helmet for $6 per hour. How many hours must you skateboard so that the costs would be the same? Write an equation. Which sentence best shows how the writers of the Beat Generation worked as artists? PLS ANSWER ASAP! Solve for x show work 4(x+1)=-3x-10