⚠️PLEASE CHECL OUT BOTH ANSWER EITHER ONE PLEASEEE OR BOTH ;) ⚠️

PLEASE CHECL OUT BOTH ANSWER EITHER ONE PLEASEEE OR BOTH ;)

Answers

Answer 1

Answer:

for the first question the answer i think would be density. i'm sorry but i can't answer the second question. i hope i helped.

Explanation:


Related Questions

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

Dependence and Addiction are the
same thing?
a. True
b. False​

Answers

Answer:

b

Explanation:

one is a necessity, the other is a struggle

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

what are thylakoids? I will give BRAINLIEST!!

Answers

Answer:

each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.

Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.

Explanation:

Answer:

They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Other Questions
Now that you have learned more about this topic, indicate whether you agree or disagree with tstatement.The most interesting jobs are those working with other people.Agree. Disagree Analyze whether the Renaissance and the Reformation would have been possible without the new technology of the printing press. What would have been different? Provide support for your ideas. Which of the following expressions simplifies to abcd, where a, b, c and d are real numbers? A. (a)b(c)d B. (a)b(c)(d) C. a(b)(c)d D. (a)(b)(c)(d) Summarize "Things That Matter. Write three to five sentences that include the most important details. What event allowed the Byzantine Empire to conquer Italy? The Great Schism The split of the Eastern Empire The Iconoclasm controversy The fall of the Western Roman Empire Ojos del Salado is the highest mountain in Chile, with a peak at about 6900 meters above sea level. The Atacama Trench, just off the coast of Peru and Chile, is about 8100 meters below sea level (at its lowest point).a. What is the difference in elevations between Mount Ojos del Salado and the Atacama Trench?b. Is the elevation halfway between the peak of Mount Ojos del Salado and the Atacama Trench above sea level or below sea level?Explain without calculating the exact value. c. What elevation is halfway between the peak of Mount Ojos del Salado and the Atacama Trench? help please 10 points based on what you've learned in this lesson list three reason why England and France would have wanted to find the Northwestern route to Asia The sum of 2 numbers is 25. The sum of their reciprocals os 1/4. Determine the two numbers. es termino excluido CANSANCIO A. Abatido B. Agotado C. Exhausto D. FatigadoE. Extenuado PLEASE ANSWER THIS ASAP !!! What is the definition of the particle? Given four values representing counts of quarters, dimes, nickels and pennies, output the total amount as dollars and cents. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: System.out.printf("Amount: $%.2f\n", dollars); Ex: If the input is: 4 3 2 1 where 4 is the number of quarters, 3 is the number of dimes, 2 is the number of nickels, and 1 is the number of pennies, the output is: Amount: $1.41 For simplicity, assume input is non-negative.LAB ACTIVITY 2.32.1: LAB: Convert to dollars 0/10 LabProgram.java Load default template. 1 import java.util.Scanner; 2 3 public class LabProgram 4 public static void main(String[] args) { 5 Scanner scnr = new Scanner(System.in); 6 7 /* Type your code here. */|| 8 9) Develop mode Submit mode Run your program as often as you'd like, before submitting for grading. Below, type any needed input values in the first box, then click Run program and observe the program's output in the second box Enter program input (optional) If your code requires input values, provide them here. Run program Input (from above) 1 LabProgram.java (Your program) Output (shown below) Program output displayed here At a grocery store, you can buy a 20-ounce of peanuts for $3.59, or you can buy a one-pound (16 ounces) package for $2.59. Why is the one-pound package the better deal? Explain your answer by talking about unit rates. What was the name of Akhenaton's capital city? * amarna Order the numbers from least to greatest.2.1,610,94,0.75, 53 Perpetual Inventory Using LIFO The following units of a particular item were available for sale during the calendar year: Jan. 1 Inventory 4,000 units at $40 Apr. 19 Sale 2,500 units June 30 Purchase 4,500 units at $44 Sept. 2 Sale 5,000 units Nov. 15 Purchase 2,000 units at $46 The firm maintains a perpetual inventory system. Determine the cost of goods sold for each sale and the inventory balance after each sale, assuming the last-in, first-out method. Present the data in the form illustrated in Exhibit 4. Under LIFO, if units are in inventory at two or more different costs, enter the units with the LOWER unit cost first in the Inventory Unit Cost column. Please help lots of points!!! Net ionic equation for aqueous solutions of perchloric acid and barium hydroxide. He later received an honorable discharge in 1944 after being acquitted of all charges at the court-martial. Which sentence BEST revises the sentence above to eliminate wordiness? A) He received an honorable discharge in 1944. B) He received an honorable discharge in 1944 after being acquitted of all charges. C) He later received an honorable discharge after being acquitted at the court-martial. D) He later received a discharge after being acquitted of all charges at the court-martial. Between what two integers is the square root of 56.25?