Which of the following relations is a function? A. (-2, -2), (-6, -5), (2, 8), (2, 2) B. (-6, 2), (-2, 3), (2, 7), (6, 2) C. (6, -10), (-6, 7), (6, 6), (-6, 12) D. (-6, 0), (-2, 5), (-6, -3), (2, 9)Which of the following relations is a function? A. (-2, -2), (-6, -5), (2, 8), (2, 2) B. (-6, 2), (-2, 3), (2, 7), (6, 2) C. (6, -10), (-6, 7), (6, 6), (-6, 12) D. (-6, 0), (-2, 5), (-6, -3), (2, 9)

Answers

Answer 1

The correct relation which shows the function is,

⇒ (-6, 2), (-2, 3), (2, 7), (6, 2)

Option B is true.

What is Function?

A relation between a set of inputs having one output each is called a function.

Now, We know that;

Function is a relation between a set of inputs having one output each.

So, By given options;

A. (-2, -2), (-6, -5), (2, 8), (2, 2)

Here, Two value of outputs 8, 2 have same input 2.

So, This is not a function.

B. (-6, 2), (-2, 3), (2, 7), (6, 2)

Here, A set of inputs having one output each.

So, This is function.

C. (6, -10), (-6, 7), (6, 6), (-6, 12)

Here, Two value of outputs - 10, 6 have same input 6.

So, This is not a function.

D. (-6, 0), (-2, 5), (-6, -3), (2, 9)

Here, Two value of outputs 0, -3 have same input -6.

So, This is not a function.

Learn more about the function visit:

https://brainly.com/question/28793267

#SPJ1


Related Questions

Help me please (no links please)

Answers

a) This part is already complete I think..

b) This is a cuboid and lateral surface area of cuboid is: 2(lb +bh + hl)

= 2( 10 × 3 + 3 × 7 + 7 × 10)

= 2(30 + 21 + 70)

= 2 × 121 = 242 cm²

Now, the area of top & bottom: lb

= 2 × 10 × 3

= 60 cm²

Neglecting the top & bottom surface area of cuboid:

= 242 - 60

= 180 cm²

c) The total surface area us 242.. I have already done that part above...

__________________________

If i have done something wrong.. please lemme know :)

A hiker maintains an average speed of 3 3/4 km/h. How many kilometers will the hiker walk in:5hrs
help

Answers

multiple 5x 3 3/4 then change to an improper fraction

PLS PLS OH YES PLS JUST HELP YES I NEED HELP PLSSSSS HELP QUICKLY PLS I GIVE BRAINLIEST I RLLY DO JUST PLS I AM YES PLS BRAINLIEST WILL BE GIVEN PLS OH PLS PEOPLE I NEED HELP FAST OH PLS NOW​

Answers

Answer:

Vaporization

Step-by-step explanation:

22. The table shows the number of students
going on a field trip. One chaperone is
needed for every 12 students.


Fifth grade students 310


Sixth grade students 305

Seventh grade students 225


Write two equations with variables that you can use to find a number of chaperones needed


How many chaperones are needed?

Answers

Answer:

Step-by-step explanation: i'd say jus divide

For Both Problems, solve for x. Show your work and explain your thinking.

Answers

We know that the inside angle of a triangle is 180 so 180 takeaway 46+86=

48 and 48/6=8

so the answer is 8

GOOD LUCK IN BRAINLY!

Answer:

x = 12°

Step-by-step explanation:

46° + 86° + 4x = 180°

132° + 4x = 180°

4x = 48°

x = 12°

Select the interval where the graph h is decreasing.

Answers

Answer: A

Step-by-step explanation:

Based on the graph, we know that it is decreasing if it is going down from left to right.

A: correct

Looking at choice A, it says the interval is from -4<x<-3. This means we have to find x=-4 and x=-3. On the graph, that interval is going down from left to right, so it is decreasing.

B: incorrect

Looking at choice B, it says the interval is from -2<x<0. This means we have to find x=-2 and x=0. On the graph, that interval is going up from left to right, so it is increasing.

C: incorrect

Looking at choice C, it says the interval is from 0<x<2. This means we have to find x=0 and x=2. On the graph, that interval is going up from left to right, so it is increasing.

D: incorrect

Since we have identified A as decreasing, then none of the above can't be the answer.

Therefore, A is the correct answer.


Pls help quickly. Calculate the bearing of Y from
Z.
N
X
135°
z+
105°
Z
Y
Not draw

Answers

The bearing of point Y from point Z is 30 degrees.

What is the bearing of a point?

The bearing of a point is the angle measured in degrees clockwise from a reference direction (usually north). To find the bearing of point Y from point Z, we need to determine the angle between the line connecting point Z to point Y and the reference direction.

we know that the bearing of point X from point Z is 135 degrees, and the bearing of point X from point Y is 105 degrees.

we can use the following mathematical relationship to find the bearing of point Y from point Z:

Bearing of Y from Z = (Bearing of X from Z) - (Bearing of X from Y)

Substituting the values we know:

Bearing of Y from Z = 135 - 105 = 30 degrees

Hence, the bearing of point Y from point Z is 30 degrees.

To learn more about bearing of a point, Visit

https://brainly.com/question/27913321

#SPJ1

11 of 5011 of 50 Questions Question 11 Three classrooms are trying to raise $1,200.00 for charity. Mrs. LeBlanc's class has raised 50% of the total needed. Mr. Patel's class has raised $235.14. Ms. Warner's class has raised one-third as much as Mrs. LeBlanc's class. How much more money is needed to reach the goal of $1,200.00

Answers

$164.86 more is needed to reach the goal of $1,200.00.

First, we need to find out how much money Mrs LeBlanc's class has raised since they have raised 50% of the total needed. We can do this by multiplying the total needed by 50%:

$1,200.00 * 50% = $600.00

Next, we need to find out how much money Ms Warner's class has raised since they have raised one-third as much as Mrs LeBlanc's class. We can do this by multiplying the amount raised by Mrs LeBlanc's class by one-third:

$600.00 * 1/3 = $200.00

Now we can add up the amount raised by all three classes to see how much has been raised in total:

$600.00 (Mrs. LeBlanc's class) + $235.14 (Mr. Patel's class) + $200.00 (Ms. Warner's class) = $1035.14

Finally, we can subtract the total amount raised from the goal amount to find out how much more is needed:

$1,200.00 - $1,035.14 = $164.86

So $164.86 more is needed to reach the goal of $1,200.00.

To learn more about the multiply, visit:

brainly.com/question/23536361

#SPJ4

I WILL GIVE BRAILIEST PLEASE HELP

Answers

Answer:

$3.49 for the muffin, and $2.96 for the coffee

Step-by-step explanation:

(3.25)(1.075) = 3.49

(2.75)(1.075) = 2.96

How to find the factor to multiply by

1.075 = 1+.075, 7.5% = 7.5/100 =  .075

2. Answer: $0.45

Explanation:

2.75x.075=.24375

3.25x.075=.20625

.24375+.20625=0.45

3. Answer: $91.80

Explanation:

85x0.08=6.80

6.80+85=91.80

4. Answer: $728.75

Explanation:

687.50x.06=41.25

41.25+687.50

5. Answer: $17.28

Explanation:

216x.08=17.28

6. Answer: $0.99

Explanation:

8.5x0.06=0.51

0.51+8.50=9.01

10-9.01=0.99

Which is equal to the cosine of

Answers

Answer:

The sine of the opposite angle

Eva gets £42 a month for her allowance. Out of this, for every £5 she spends, she saves £1 how much money does she spend in a month

Answers

Answer:

Eva spends £35 in a month.

Step-by-step explanation:

We know that Eva gets £42 a month for her allowance and for every £5 she spends, she saves £1.

We are looking to find out how much money does she spend in a month.

To calculate this, we can use the following formula:

Spent money = Allowance - (Allowance / (5 + 1))

Plugging in the known values:

Spent money = 42 - (42 / (5 + 1))

Spent money = 42 - (42 / 6)

Spent money = 42 - 7

Spent money = 35

So, Eva spends £35 in a month.

What is the answer to inequality?

Answers

The direction of inequality is reversed when you multiply or divide both sides by a negative value.

When expressions are compared using the operators "less than" (), "less than or equal to" (=), "greater than" (>), or "greater than or equal to" (>=), an inequality is created.

Example- x + 3 <= 10

A solution for an inequality in x is a number such that when we substitute that number for x we have a true statement. So, 4 is a solution for example 1, while 8 is not.

The solution set of an inequality is the set of all solutions.

The solution set of example 1 is the set of all x <= 7. In interval notation, this set is (-inf, 7], where we use inf to stand for infinity.

To know more about inequality visit: brainly.com/question/28823603

#SPJ4

Mhanifa please help! This is due soon

Answers

Answer:

By using the Pythagorean theorem, the sides form a right triangle:

36^2 + 15^2 = 39^2

please help me on this question. i can give brainliest!!

Answers

Answer:

The correct answers are A D E

Step-by-step explanation:

Is 9x2 42x 49 a perfect square trinomial?

Answers

No, 9x2 42x 49 is not a perfect square trinomial.

What is perfect squares?

Perfect squares are numbers that are the product of a number multiplied by itself. Examples of perfect squares include 4 (2 x 2), 9 (3 x 3), 16 (4 x 4), 25 (5 x 5), 36 (6 x 6), 49 (7 x 7), and 64 (8 x 8). Perfect squares are also referred to as "square numbers" or "whole-number squares."

No, 9x2 42x 49 is not a perfect square trinomial. A perfect square trinomial is a polynomial of the form a2 + 2ab + b2,

where a and b are numbers or variables.

9x2 42x 49 does not fit this pattern, as it does not involve two terms whose sum is multiplied by itself.

To know more about perfect squares click-
https://brainly.com/question/27307830
#SPJ4

Tacoma's population in 2000 was about 200 thousand, and has been growing by about 8% each year. If this continues, what will Tacoma's population be in 2012?

Answers

Answer:

503634

Step-by-step explanation:

The formula for calculating future value:

FV = P (1 + r) n

FV = Future value  

P = Present value  

R = interest rate  

N = number of years  

200,000(1.08)^12

A quadratic equation is shown below: x2 − 8x + 13 = 0 Which of the following is the first correct step to write the above equation in the form (x − p)2 = q, where p and q are integers? (5 points) Subtract 5 from both sides of the equation Subtract 3 from both sides of the equation Add 5 to both sides of the equation Add 3 to both sides of the equation

Answers

Answer:

Add 3 to both sides of the equation

Solution:

The first step is to basically realize that all it's asking you to do is to find a way to make the expression on the left ([tex]x^2 - 8x + 13[/tex]) into an expression that is a perfect square. So what number should you add to both sides such that [tex]x^2 - 8x + (13 + j)[/tex] can be factored into [tex](x-p)^2[/tex] ? Well, we can approach it like this:

Since [tex](x-p)^2[/tex] can be turned into [tex]x^2 -2px + p^2[/tex], and our original form was [tex]x^2 - 8x + (13 + j)[/tex], we quickly realize that [tex]-2px = -8x[/tex]. From there, we can easily tell that [tex]p = 4[/tex]

Plug this into our last value [tex]p^2[/tex] to get 16. Therefore, if we compare this with our original equation again [tex]x^2 - 8x + (13 + j)[/tex], we notice that 13 + j = 16.

Thus, j = 3 for the last answer.

Add 3 to both sides of the equation.

Note: With more practice, you will quickly gain enough intuition to notice that [tex]x^2 - 8x + 13[/tex] is very close to [tex]x^2 - 8x + 16[/tex] which can be factored into [tex](x-4)^2[/tex]. But for now, the solution above will suffice. I hope this helps :))

Can some help me with my delta math I’m failing my math class

Answers

Answer:

Same

Step-by-step explanation:

Answer:

same

Step-by-step explanation:

help me please it’s simple :( thank u

Answers

All have 4 sides. That’s what I would put. Good luck and don’t copy links they’re most likely viruses

The function f is defined by f(x) = mx + b, where m and b are constants. If f(0) = 18 and f(1) = 20, what is the
value of m?

Answers

A mathematical constant is a key number whose value is fixed by an unambiguous definition, often referred to by a symbol.

What are 3 examples of a constant?

A few more constant examples are :

The number of days in a week represents a constant.

In the expression 5x + 10, the constant term is 10.In 2a, 2 is a constant.In -7mn, -7 is a constant.In 3x, 3 is constant.A fixed value. In Algebra, a constant is a number on its own, or sometimes a letter such as a, b or c to stand for a fixed number. Example: in "x + 5 = 9", 5 and 9 are constants.There are four major constants that appear within mathematical calculations. These math constants are used in a whole variety of equations and formulae and are repeatedly seen in a variety of areas.The easiest way we can find a constant term in math is to look first for stand-alone numbers, and then for coefficients and variables that can be solved for. A variable cannot be solved for and return only one value if it has an exponent, such as x^2.A function is called no constant if it takes more than one value (if there is more than one element in its range).

Substitute:

m*o+b=18

m+b=20

Apply Zero Property of Multiplication:

b=18

m+b=20

Substitute into one of the equations:m+18=20

Rearrange unknown terms to the left side of the equation:m=20-18

Calculate the sum or difference:m=2

The solution of the system is:

b=18

m=2

The answer is b=18 m=2

To learn more about constants refer to:

https://brainly.com/question/28581458

#SPJ1

can someone please help me with this math problem! thank you! :)

Answers

9514 1404 393

Answer:

  see attached

Step-by-step explanation:

The sides marked on the triangle are adjacent to and opposite the given angle. The mnemonic SOH CAH TOA is intended to remind you which trig functions relate which sides. The one applicable here is TOA:

  Tan = Opposite/Adjacent

Using the values on the diagram, we have ...

  tan(65°) = 18/y

Multiplying by y/tan(65°) gives ...

  y = 18/tan(65°)

  y ≈ 8.3935 ≈ 8.4

I need help not bad like ASAP but need help

Answers

The inverse of this function is f(x) = 3x - 6.
You can find the inverse of any function by switching the f(x) and × values. Once you've done that, solve for the new f(x). The result will be the inverse function. The step-by-step process is below.

The hexagon below has been reduced by a scale factor of One-third.

What is the area of the reduced hexagon?
8 inches squared
12 inches squared
24 inches squared
36 inches squared

Answers

Answer:

8

Step-by-step explanation:

Circumference question

1. Suppose a bottle of Buckley's has a radius of 2cm. You need to
create a label for this product. What is the length of this label?


2. Assumes the company uses 22cm x 12cm boxes for delivery to stores. How many vials will be in each box?


suppose the price of each vial is $5.00. What is the cost of a box?

Answers

12.57 cm is the length of the label on bottle.

What is Circle?

A circle is a shape consisting of all points in a plane that are at a given distance from a given point, the centre.

Given that a  bottle of Buckley's has a radius of 2cm

You need to create a label for this product

We need to find the length of this label.

Means we need to find the circumference of the bottle.

The formula for circumference is

C=2πr

Given radius is 2cm

C=2×3.14×2

C=12.57 cm

Hence, 12.57 cm is the length of the label on bottle.

To learn more on Circles click:

https://brainly.com/question/11833983

#SPJ1

What is the value of the expression 9 + ( fraction 1 over 2 )4 ⋅ 48? (1 point)

A. 12

B. 15

C. 17

D. 18

Answers

Answer:

A. 12

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Step-by-step explanation:

Step 1: Define

9 + (1/2)⁴ · 48

Step 2: Evaluate

Exponents:                                                                                                        9 + 1/16 · 48Multiply:                                                                                                             9 + 3Add:                                                                                                                   12

Part 1
Hi I really need help with some of these questions please I'm on a tight schedule with getting the rest of my work done so please if anyone can please help me I'm giving 45 points away please help me.

Also on the ones where you need to show the work please do if you can

I will post another part or these question and it will be worth 30 points

Answers

Answer:

1) c. AD || CE

2) solve them both first:

3y + 1 = 6x + 4                2y + 1 = x - 9

3y = 6x + 3                     2y = x - 10

y = 2x + 1 .                      y = 1/2x - 5

Parallel lines should have the same slope and they are definitely not the same line, so both A and C are eliminated

Perpendicular slopes should be negative reciprocals of each other. If they were negative reciprocals one slope would be either -2 or -1/2, which means that they're not perpendicular either.

The answer is D, neither parallel nor perpendicular.

3) to find the midpoint of a line, add the x coordinates and divide by 2 and add the y coordinates and divide by 2.

[tex](\frac{-6+1}{2},\frac{1+8}{2} )\\\\=(\frac{-5}{2},\frac{9}{2} )\\\\=(-2\frac{1}{2} ,4\frac{1}{2} )[/tex]

The answer is D.

4) d. GB || HC

5) d. 345.6

[tex]A=2\pi rh\\\\A=2\pi (5)(11)\\\\A=2\pi (55)[/tex]

A ≈ 345.58 ≈ 345.6

6) first change the other equation (4x + 2y = 10) to slope-intercept form:

2y = -4x + 10

y = -2x + 5

because the line must be parallel, it has to have a slope = -2

That automatically eliminates all answers except for D, so you don't even have to do the work to make the other equation.

7) best bet is a. EH and BC are coplanar, but I'm really not sure

8) d. DB and HF

9) first change the other equation (4x - 6y = 15) to slope-intercept form:

-6y = -4x + 15

y = 2/3x - 5/2

slope of the perpendicular line should be -3/2

y = -3/2x + a

9 = -3/2(6) + a

9 = -9 + a

a = 18

y = -3/2x + 18

which is the same as y - 9 = -3/2(x - 6), which is A

Steven is training for a race. He can currently run 1 mile in 7 minutes and wants to improve his time by 10 seconds each week until he can run one mile in 5 minutes. Which equation should Steven use to calculate the number of weeks (w) it will take him to reach his goal time of 5 minutes?
a) 7 - 10w = 5
b) 10w + 7 = 5
c) 10w - 7(60) = 5(60)
d) 7(60) - 10w = 5(60)

Answers

The answer is d I hope this helps

By some estimates, about 30% of all males have a particular defect related to their eyes. How would you assign random numbers to conduct a simulation based on this
statistic?

Answers

Answer:

related to their eyes. How would you assign random numbers to conduct a simulation based on this

Item 9

Use the table to write a proportion. Game 1 6 penelties 16 minutes game 2 8 penelties m minutes how many minutes and what is a proportion

Answers

The value of the minutes in the game 2 is 3 and the proportion is 8/3.

As per the question,

Game 1 has, 6 penalties in 16 minutes and Game 2 has 8 penalties in m minutes.

Now, we have to form a proportion,

A proportion is a fractional relation between any two quantities.

So, if we say that the penalties in every game are in proportion, we write a proportion of penalties per minute.

6/16 = 8/m

m = 6x8/16

m = 3

So, the penalties in the game 2 are 3 and the proportion is 8/3.

To know more about Proportion, visit,

https://brainly.com/question/19994681

#SPJ4

At a yard sale,Dan bought a used lawnmower for $60. that was 30% of what the mower cost when it was new. What was the original price of the lawnmower?

Answers

Answer:

30/100 X $60= $18.

The original price will be $60 + $18 = $78.

Other Questions
Math homework please help look at picture!! briefly describe the goals and scope of social work. she is drinking water change into negative Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on